ISI Impact Factor (2004): 1.096


   
 

Editor-in-Chief
Prof. Yi-Fei WANG,

 
     

   

Castration-induced expression of caspase-1 in epithelia of  accessory sex organs in male rats

Masao Izawa1, Mitunori Kimura2, Tomiko Yamada1, Makoto Saji2

Departments of 1Biosignaling and 2Neurobiology, School of Life Science, Faculty of Medicine, Tottori University, Yonago 683-8503 , Japan

Asian J Androl  2001 Jun; 3:  105-108


Keywords: prostate; seminal vesicles; tissue involution; apoptosis; caspase-1; cDNA; cloning; castration; epithelium; rats
Abstract

Aim: As an attempt to clarify the molecular basis of castration-induced apoptosis, this study was undertaken to demonstrate the expression of caspase-1 in male accessory sex organs of rats. Methods and results:  cDNA of rat caspase-1 was cloned by reverse transcription-polymerase chain reaction from the ventral prostates. The open reading frame predicts 402 amino acids, which shows more than 91% and 63% identity to those of mouse and human, respectively. Northern analyses demonstrated the presence of castration-induced up-regulation of the 1.6 kb transcript in the ventral prostate and the seminal vesicles. Finally, the authors demonstrated the caspase-1 transcripts in the epithelia of these tissues by in situ hybridization analyses. Conclusion: Castration induces the expression of caspase-1 transcripts in the epithelia of ventral prostate and seminal vesicle. These observations suggest a possible role of caspase-1 in apoptosis in male accessory sex organs.

1 Introduction
Cell death in concert with cell proliferation is important in the maintenance of tissue homeostasis. Androgen-dependent tissues involute after orchidectomy and the process is now understood as apoptotic cell death[1-3]. From a number of apoptosis-related genes, the caspase family members have been shown to take the key role in the regulatory steps for apoptosis[4]. Caspases are activated sequentially to cleave various intracellular substrates, and a series of these proteolysis leads to the final goal of apoptosis[4]. Among at least 14 caspases identified so far[4], caspase-1 is the first member of the family, and its enforced expression in rat fibroblasts induced apoptosis, which could be prevented by the overexpression of bcl-2 and crmA[5,6]. Moreover, caspase-1 is upregulated and activated in some cell types undergoing apoptosis[7], and studies with caspase-1-deficient mice have demonstrated that Fas-mediated apoptosis in thymocytes appears to require caspase-1[8,9]. The aim of this study was to determine the caspase-1 expression in male accessory sex organs. We cloned a caspase-1 cDNA from rat ventral prostates, and demonstrated for the first time the castration-induced expression in the epithelia of ventral prostate and seminal vesicles.
2 Materials and methods

2.1 Animals and RNA preparation

Male Wistar rats weighing 300-330 g were used. Castration of animals was performed via the scrotal route under ether anesthesia. The ventral prostates and the seminal vesicles were removed from at least 6 animals, and immediately used for RNA preparation in each experimental group. Tissue RNA was prepared by Trisol (GIBCO BRL). Poly(A+) RNA was separated by using oligotex-dT30 (Takara). Procedures for animal care and their use were conducted under the Guidelines for Animal Experimentation, Faculty of Medicine, Tottori University (restricted publication) and the international laws (NIH guide for the care and use of laboratory animals, NIH publication 85-23, 1985) and policies.

2.2 cDNA cloning by reverse transcription-polymerase chain reaction (RT-PCR)

For RT-PCR cloning of rat caspase-1 cDNA, two micrograms of poly(A+)RNA from the ventral prostate of intact rats were reverse-transcribed in 20 μL of reaction mixture containing 0.5 μg of oligo-(dT)15 and 200 units of Superscript (RNase H- reverse transcriptase, GIBCO BRL). An aliquot (1 μL) of the reaction mixture was added to 98 μL of the PCR mixture supplemented with 50 pmol aliquots of primers (RICEF, 5′GCATGGCTGACAAGATCCTGAGGG3′; RICER, 5′GGATTGTTCGTTTAATGTCCCGGG3′) which had been synthesized according to the mice cDNA sequence[12] to amplify a potential ORF. To amplify the 3′ sequence including poly(A+) tail, oligo-(dT)15 instead of RICER was included in the PCR mixture. Immediately after addition of 2.5 units of Amplitaq DNA polymerase (1 μL, PERKIN ELMER CETUS), the PCR reaction was started in a DNA thermal cycler (PC-700, Astek), 0.5 min at 94℃, 1 min at 60℃ and 1 min at 72℃, for 39 cycles. At the end of PCR, 18 μL of the reaction mixture was removed and subjected to electrophoresis in a 1.8% agarose gel in TBE buffer at a constant voltage of 100 V. An amplified band of approximately 1200 bp in the gel was cut out, purified with phenol-chloroform, and then cloned into SmaI site of pUC19. E. coli JM109 was transformed with the recombinant plasmid. Sixty positive clones were sequenced by the dideoxynucleotide chain termination procedure.

2.3 Northern blot and RNA slot blot analyses

Ten μg of tissue RNA from the ventral prostate and the seminal vesicles of intact or castrated animals were electrophoresed on a 1.2% denaturing agarose gel containing formaldehyde, transferred onto a nylon membrane (N+, Amersham), and hybridized to the 32P-labeled caspase-1 cDNA. Fifteen μg of tissue RNAs were used for RNA slot blot analysis. Conditions for hybridization, washing and exposure to X-ray films were exactly the same as described[3].

2.4 In situ hybridization

Animals, which had been castrated for 48 h, were anesthetized with intraperitoneal sodium pentobarbital (40 mg/kg b.w.) and perfused transcardially with heparinized saline (1.7 units/mL) followed by phosphate-buffered (0.1 mol/L, PH 7.4) 4% paraformaldehyde. Tissues were removed, prefixed in the fixative for 1 h, and immersed overnight at 4℃in 30% sucrose. The prostates and the seminal vesicles were removed, processed and sectioned on a microtome into 40 μm sections, which were then processed for in situhybridization with digoxigenin-labelled cRNA probes as described previously[14]. The digoxigenin-labelled caspase-1 cRNA antisense probes were synthesized by transcription of rat caspase-1 cDNA cloned downstream of T7 promoters with T7 RNA polymerases using digoxigenin-labelled uridine triphosphate as substrate (DIG RNA labelling kit, Boehringer Mannheim). The sections were prehybridized at 55℃for 3 h in 50% formamide, 10% dextran, 2×Dendardt‘s solution, 2×SSC, 0.5 mg/mL denatured herring sperm DNA, 1 mg/mL yeast tRNA and 0.25% SDS. Hybridization with digoxigenin-labeled cRNA probes was initiated by adding the probes (10 ng/mL) to the prehybridization mixture. At the end of hybridization at 55℃ for 16 h, sections were washed as follows: once with 2×SCC supplemented with 50% formamide at 52℃ for 20min, then twice with 2×SSC at 37℃for 10 min, followed by RNase A treatment (100 μg/mL in 2×SSC) at 37℃ for 30 min, and finally rinsed 3 times with a series of SSC (2×SSC, 1×SSC and 0.5×SSC,) at 50℃ for 10 min. Then sections were processed for immunohistochemistry using anti-digoxigenin alkaline phosphatase conjugate (1/500 dilution, Boeringer Mannheim). To visualize hybridized signals, the sections were incubated in a reaction mixture of X-phosphate and nitro blue tetrazolium salt for 48 h, and then mounted on slides.

3 Results and discussion

cDNA of rat caspase-1 from the ventral prostates was cloned and the nucleotide sequence (Figure 1) deposited in DDBJ/EMBL/GenBank with an accession number D85899. The sequence analysis of 1325 nucleotides in length predicted an open reading frame of 402 amino acids, which is highly homologous to those of mouse (91%) and human (61%). Northern blot analysis using the cDNA as probe demonstrated a transcript of 1.6 kb both in the ventral prostate and the seminal vesicles (Figure 2A). Within 48 h after castration of animals, steady state levels of the transcript increased to approximately three-fold that of the intact control (Figures 2A and 2B).

Figure 1. Nucleotide and deduced amino acid sequences of rat caspase-1.  
Figure 2
.  Effect of castration on the expression of caspase-1 transcript

Finally, in situ hybridization analyses demonstrated caspase-1 transcripts in the epithelia of ventral prostate and seminal vesicles from animals castrated  for 48 h (Figure 3), where castration-induced apoptosis was observed[1,2].

Figure 3. Expression of caspase-1 transcripts in epithelia of ventral prostate and seminal vesicle : in situ hybridization analysis. Intact or castrated (48 h) animals were used. Representative results from an anti\|sense (Left) and a sense (Right) probe. Scale bar 10 μm.

In conclusion, we demonstrated for the first time the castration-induced up-regulation of caspase-1 transcripts in the epithelia of ventral prostate and seminal vesicles of rats. It becomes of particularly importance to examine the castration-induced apoptosis in male accessory sex organs by using caspase-1-deficient mice. Although caspase-1 was first isolated as a cysteine protease to cleave an inactive pro-IL-1β to generate an active IL-1β[10], it is interesting to note that the expression has been demonstrated in a variety of cell types and tissues where IL-1 β is not produced[11-13].

in the ventral prostate and the seminal vesicle: tissue RNA from at least 6 animals in each experimental group were used. (A) Northern blot (upper panel). Tenμg of tissue RNA was seperated on a garose gel electrophoresis. The location of 28 S and 18 S ribosomal RNA was indicated on the left of lanes as molecular size markers. The lower panel shows the electrophoretic patterns of tissue RNA. (B) RNA slot blot. Fifteen μg of tissue RNA were blotted.  I: Intact animal; C24, C48, C72 and C96: animals castrated for 24, 48, 72 and 96 h, respectively.

References

[1] Kyprianou N, Isaacs JT. Activation of programmed cell death in the ventral prostate after castration. Endocrinology 1998; 122: 552-62.
[2] Nickerson T, Pollak M, Huynuth H. Castrationi-induced apoptosis in the rat ventral prostate is associated with increased expression of genes encoding insulin-like growth factor binding proteins 2,3,4 and 5. Endocrinology 1998; 139: 887-90.
[3] Izawa M. Expression of sulfated glycoprotein 2 and pSvr-1 genes and involution of steroid hormone-dependent rat tissues. Endocrinol Japan 1991; 38: 61-6.
[4] Thornberry N, Lazebnik Y. Caspases: enemy within. Science 1998; 281: 1312-6.
[5] Miura M, Zhu H, Rotello R, Hartwig EA, Yuan J. Induction of apoptosis in fibroblasts by IL-1β-converting enzyme, a mammalian homolog of the C. elegans cell death gene ced-3. Cell 1993; 75: 653-60.
[6] Gagliarini V, Fernadez PA, Lee RKK, Drexler HCA, Rotello RJ, Fishman MC, Yuan J. Prevention of vertebrate neuronal death by crmA gene. Science 1994; 263: 826-8.

[7] Boudreau N, Sympson CJ, Werb Z, Bissell MJ. Suppression of ICE and apoptosis in mammary epithelial cells by extracellular matrix. Science 1995; 267: 891-3.

[8] Kuida K, Lippke JA, Ku G, Harding MW, Livingston DJ, Su MSS, Flavell RA. Altered cytokine export and apoptosis in mice deficient in interleukin-1β converting enzyme. Science 1995; 267: 2000-3.
[9] Los M, Van de Craen M, Penning LC, Schenk H, Westendorp M, Baeuerle PA, et al. Requirement of ICE/CED-3 protease for Fas/APO-1-mediated apoptosis. Nature 1995; 375: 81-3.
[10] Thornberry NA, Bull HG, Calaycay JR, Chapman KT, Howard AD, Kostura MJ, et al. A novel heterodimeric cysteine protease is required for interleukin-1β processing in monocytes. Nature 1992; 356: 768-74.
[11] Cerretti DP, Kozlosky CJ, Mosley B, Nelson N, Ness KV, Greenstreet TA, et al. Molecular cloning of the interleukin-1β converting enzyme. Science 1992; 256: 97-100.
[12] Nett MA, Cerretti DP, Berson DR, Seavitt J, Gilbert DJ, Jenkins NA, et al. Molecular cloning of the murine IL-1β converting enzyme cDNA. J Immunol 1992; 149: 3254-9.
[13] Alnemri ES, Fernandes-Alnemri T, Litwack G. Cloning and expression of four ovel isoforms of human interleukin-1β converting enzyme with different apoptotic activities. J Biol Chem 1995; 270: 4312-7.

[14] Saji M, Kimura M, Ishida G, Ohno K. Deafferentation-induced c-fos gene expres
sion in subthalamic nucleus and substantia nigra reticulata is reduced by non-NMDA receptor agonist. Brain Res 1995; 703: 165-74.

home


Correspondence to: Masao Izawa, Ph.D., Department of Biosignaling, School of Life Science,  Faculty of Medicine, Tottori University, 86-Nishi-machi, Yonago, 683-8503, Japan. 
Tel/Fax : +81-859-34 8042    E-mail: 1mizawa@grape.med.tottori-u.ac.jp

Received 2001-04-06            Accepted 2001-05-01