Castration-induced
expression of caspase-1 in epithelia of
accessory sex organs in male rats
Masao
Izawa1, Mitunori Kimura2, Tomiko Yamada1,
Makoto Saji2
Departments
of 1Biosignaling and 2Neurobiology, School of Life
Science, Faculty of Medicine, Tottori University, Yonago 683-8503 , Japan
Asian
J Androl 2001 Jun; 3: 105-108
Keywords:
prostate;
seminal vesicles; tissue involution; apoptosis; caspase-1; cDNA;
cloning; castration; epithelium; rats
Abstract
Aim:
As
an attempt to clarify the molecular basis of castration-induced apoptosis,
this study was undertaken to demonstrate the expression of caspase-1 in
male accessory sex organs of rats. Methods and results: cDNA
of rat caspase-1 was cloned
by reverse transcription-polymerase chain reaction from the ventral prostates.
The open reading frame predicts 402 amino acids, which shows more than
91% and 63% identity to those of mouse and human, respectively. Northern
analyses demonstrated the presence of castration-induced up-regulation
of the 1.6 kb transcript in the ventral prostate and the seminal vesicles.
Finally, the authors demonstrated the caspase-1 transcripts in the epithelia
of these tissues by in situ hybridization analyses.
Conclusion: Castration
induces the expression of caspase-1 transcripts in the epithelia of ventral
prostate and seminal vesicle. These observations suggest a possible role
of caspase-1 in apoptosis in male accessory sex
organs.
1
Introduction
Cell
death in concert with cell proliferation is important in the maintenance
of tissue homeostasis. Androgen-dependent tissues involute after orchidectomy
and the process is now
understood as apoptotic cell death[1-3]. From a
number of apoptosis-related
genes, the caspase family members have been shown to take the key
role in the regulatory steps for apoptosis[4]. Caspases are activated
sequentially to cleave various intracellular substrates, and a series of
these proteolysis leads to the final goal of apoptosis[4]. Among
at least 14 caspases identified
so far[4], caspase-1 is the first member of the family, and its
enforced expression in rat fibroblasts induced apoptosis, which could be
prevented by the overexpression of bcl-2 and crmA[5,6]. Moreover,
caspase-1 is upregulated and
activated in some cell types undergoing apoptosis[7], and studies
with caspase-1-deficient mice have demonstrated that Fas-mediated apoptosis
in thymocytes appears to
require caspase-1[8,9]. The aim of this study was to determine
the caspase-1 expression in male accessory sex organs. We cloned a caspase-1
cDNA from rat ventral prostates, and demonstrated for the first time the
castration-induced expression in the epithelia of ventral
prostate and seminal vesicles.
2
Materials
and methods
2.1
Animals and RNA preparation
Male
Wistar rats weighing 300-330 g were used. Castration of animals was performed
via the scrotal route under ether anesthesia. The ventral prostates and
the seminal vesicles were removed from at least 6 animals, and immediately
used for RNA preparation in each experimental group. Tissue RNA was prepared
by Trisol (GIBCO BRL). Poly(A+) RNA was separated by using
oligotex-dT30 (Takara). Procedures for animal care and their
use were conducted under the Guidelines for Animal Experimentation, Faculty
of Medicine, Tottori University (restricted publication) and the international
laws (NIH guide for the care and use of laboratory animals, NIH publication
85-23, 1985) and policies.
2.2
cDNA cloning by reverse transcription-polymerase chain reaction
(RT-PCR)
For
RT-PCR cloning of rat caspase-1 cDNA, two micrograms of poly(A+)RNA
from the ventral
prostate of intact rats were reverse-transcribed in 20 μL of
reaction mixture containing 0.5 μg of oligo-(dT)15 and 200
units of Superscript (RNase H- reverse transcriptase, GIBCO
BRL). An aliquot (1 μL) of the reaction mixture was added
to 98 μL of the PCR mixture supplemented with 50 pmol aliquots of primers (RICEF,
5′GCATGGCTGACAAGATCCTGAGGG3′; RICER, 5′GGATTGTTCGTTTAATGTCCCGGG3′)
which had been synthesized according to the mice cDNA sequence[12]
to amplify a potential ORF. To amplify the 3′ sequence including poly(A+)
tail, oligo-(dT)15 instead
of RICER was included in the PCR mixture. Immediately after addition of
2.5 units of Amplitaq DNA polymerase (1 μL, PERKIN ELMER CETUS), the
PCR reaction was started in a DNA thermal cycler (PC-700, Astek), 0.5
min at 94℃, 1 min at 60℃
and 1 min at 72℃, for 39 cycles. At the end of PCR, 18 μL of the
reaction mixture was
removed and subjected to electrophoresis in a 1.8% agarose gel in TBE
buffer at a constant voltage of 100 V. An amplified band of approximately 1200
bp in the gel was cut out, purified with phenol-chloroform, and then cloned
into SmaI site of pUC19. E. coli JM109 was transformed with the recombinant
plasmid. Sixty positive clones were sequenced by the dideoxynucleotide
chain termination procedure.
2.3
Northern blot and RNA slot blot analyses
Ten
μg of tissue RNA from the ventral prostate and the seminal vesicles of
intact or castrated animals were electrophoresed on a 1.2% denaturing
agarose gel containing formaldehyde, transferred onto a nylon membrane
(N+, Amersham), and hybridized to the 32P-labeled
caspase-1 cDNA. Fifteen μg of tissue RNAs were used for RNA slot blot
analysis. Conditions for hybridization, washing and exposure to X-ray
films were exactly the same as described[3].
2.4
In situ hybridization
Animals,
which had been castrated for 48 h, were anesthetized with intraperitoneal
sodium pentobarbital (40 mg/kg b.w.) and perfused transcardially with heparinized
saline (1.7 units/mL) followed by phosphate-buffered (0.1 mol/L, PH 7.4)
4% paraformaldehyde. Tissues were removed, prefixed in the fixative for
1 h, and immersed overnight at 4℃in 30% sucrose. The prostates and the
seminal vesicles were removed, processed and sectioned on a microtome into
40 μm sections, which were then processed for in situhybridization with
digoxigenin-labelled cRNA probes as described previously[14].
The digoxigenin-labelled caspase-1 cRNA antisense probes were synthesized
by transcription of rat caspase-1 cDNA cloned downstream of T7 promoters
with T7 RNA polymerases using digoxigenin-labelled
uridine triphosphate as substrate (DIG RNA labelling kit, Boehringer Mannheim).
The sections were prehybridized at 55℃for 3 h in 50% formamide, 10% dextran,
2×Dendardt‘s solution, 2×SSC, 0.5 mg/mL denatured herring sperm
DNA, 1 mg/mL yeast tRNA and 0.25% SDS. Hybridization with digoxigenin-labeled
cRNA probes was initiated by adding the probes (10 ng/mL) to the prehybridization
mixture. At the end of hybridization at 55℃ for 16 h, sections were washed
as follows: once with 2×SCC supplemented with 50% formamide at 52℃ for
20min, then twice with 2×SSC at 37℃for 10 min, followed by RNase A treatment
(100 μg/mL in 2×SSC) at 37℃ for 30 min, and finally rinsed 3 times
with a series of SSC (2×SSC, 1×SSC and 0.5×SSC,) at 50℃ for 10 min.
Then sections were
processed for immunohistochemistry using anti-digoxigenin alkaline phosphatase
conjugate (1/500 dilution, Boeringer Mannheim). To visualize hybridized
signals, the sections were incubated in a reaction mixture of X-phosphate
and nitro blue
tetrazolium salt for 48 h, and then mounted on slides.
3
Results and discussion
cDNA
of rat caspase-1 from the ventral prostates was cloned and the nucleotide sequence
(Figure 1) deposited
in DDBJ/EMBL/GenBank with an accession number D85899. The sequence analysis
of 1325 nucleotides in length predicted an open reading frame of 402 amino
acids, which is highly homologous to those of mouse (91%) and human (61%).
Northern blot analysis using the cDNA as probe demonstrated a transcript of
1.6 kb both in the ventral prostate and the seminal vesicles (Figure
2A). Within 48 h after castration of animals, steady state levels
of the transcript increased to approximately three-fold that of the intact
control (Figures
2A and 2B).
Figure
1. Nucleotide and deduced amino acid sequences of rat caspase-1.
Figure 2. Effect
of castration on the expression of caspase-1 transcript
Finally,
in situ hybridization analyses demonstrated caspase-1 transcripts
in the epithelia of ventral prostate and seminal vesicles from animals
castrated for 48
h (Figure 3),
where castration-induced apoptosis was observed[1,2].
Figure
3. Expression of caspase-1 transcripts in epithelia of ventral prostate
and seminal vesicle : in situ hybridization analysis. Intact or
castrated (48 h) animals were used. Representative results from an anti\|sense
(Left) and a sense (Right) probe. Scale bar 10 μm.
In
conclusion, we demonstrated for the first time the castration-induced
up-regulation of caspase-1 transcripts in the epithelia of ventral prostate
and seminal vesicles of rats. It becomes of particularly importance to
examine the castration-induced apoptosis in male accessory sex organs
by using caspase-1-deficient mice. Although caspase-1 was first isolated
as a cysteine protease
to cleave an inactive pro-IL-1β to generate an active IL-1β[10],
it is interesting to note that the expression has been demonstrated in
a variety of cell types and tissues where IL-1 β is not produced[11-13].
in
the ventral prostate and the seminal vesicle: tissue RNA from at least
6 animals in each experimental group were used. (A) Northern blot (upper
panel). Tenμg of tissue RNA was
seperated on a garose gel electrophoresis. The location of 28 S
and 18 S ribosomal RNA was indicated on the left of lanes as molecular
size markers. The lower panel shows the electrophoretic patterns of tissue
RNA. (B) RNA slot blot. Fifteen
μg of tissue RNA were blotted. I: Intact animal; C24, C48, C72
and C96: animals castrated for 24, 48, 72 and 96 h, respectively.
References
[1]
Kyprianou N, Isaacs JT. Activation of programmed cell death in the ventral
prostate after castration. Endocrinology 1998; 122: 552-62.
[2] Nickerson T, Pollak M, Huynuth H. Castrationi-induced apoptosis in
the rat ventral prostate is associated with increased expression of genes
encoding insulin-like growth factor binding proteins 2,3,4 and 5. Endocrinology
1998; 139: 887-90.
[3] Izawa M. Expression of sulfated glycoprotein 2 and pSvr-1 genes and
involution of steroid hormone-dependent rat tissues. Endocrinol Japan
1991; 38: 61-6.
[4] Thornberry N, Lazebnik Y. Caspases: enemy within. Science 1998; 281:
1312-6.
[5] Miura M, Zhu H, Rotello R, Hartwig EA, Yuan J. Induction of apoptosis
in fibroblasts by IL-1β-converting enzyme, a mammalian homolog of the
C. elegans cell death gene ced-3. Cell 1993; 75: 653-60.
[6] Gagliarini V, Fernadez PA, Lee RKK, Drexler HCA, Rotello RJ, Fishman
MC, Yuan J. Prevention of vertebrate neuronal death by crmA gene. Science
1994; 263: 826-8.
[7] Boudreau N, Sympson CJ, Werb Z, Bissell MJ. Suppression of ICE and
apoptosis in mammary epithelial cells by extracellular matrix. Science
1995; 267: 891-3.
[8] Kuida K, Lippke JA, Ku G, Harding MW, Livingston DJ, Su MSS, Flavell
RA. Altered cytokine export and apoptosis in mice deficient in interleukin-1β converting
enzyme. Science 1995; 267: 2000-3.
[9] Los M, Van de Craen M, Penning LC, Schenk H, Westendorp M, Baeuerle
PA, et al. Requirement
of ICE/CED-3 protease for Fas/APO-1-mediated apoptosis. Nature 1995; 375:
81-3.
[10] Thornberry NA, Bull HG, Calaycay JR, Chapman KT, Howard AD, Kostura
MJ, et al. A novel heterodimeric cysteine protease is required
for interleukin-1β processing
in monocytes. Nature 1992; 356: 768-74.
[11] Cerretti DP, Kozlosky CJ, Mosley B, Nelson N, Ness KV, Greenstreet
TA, et al. Molecular
cloning of the interleukin-1β converting enzyme. Science 1992; 256: 97-100.
[12] Nett MA, Cerretti DP, Berson DR, Seavitt J, Gilbert DJ, Jenkins NA,
et al. Molecular cloning of the murine IL-1β converting enzyme
cDNA. J Immunol 1992; 149: 3254-9.
[13] Alnemri ES, Fernandes-Alnemri T, Litwack G. Cloning and expression
of four ovel isoforms of human interleukin-1β converting enzyme with
different apoptotic activities. J Biol Chem 1995; 270: 4312-7.
[14] Saji M, Kimura M, Ishida G, Ohno K. Deafferentation-induced c-fos
gene expression
in subthalamic nucleus and substantia nigra reticulata is reduced by non-NMDA
receptor agonist. Brain Res 1995; 703: 165-74.
home
Correspondence
to:
Masao Izawa, Ph.D., Department of Biosignaling,
School of Life Science,
Faculty of Medicine, Tottori University, 86-Nishi-machi, Yonago,
683-8503, Japan.
Tel/Fax : +81-859-34 8042 E-mail: 1mizawa@grape.med.tottori-u.ac.jp
Received 2001-04-06
Accepted 2001-05-01
|
|