ISI Impact Factor (2004): 1.096


   
 

Editor-in-Chief
Prof. Yi-Fei WANG,

 
     

   

Rodent epididymal cDNAs identified by sequence homology to human and canine counterparts

Katrin Käpler-Hanno, Christiane Kirchhoff 

IHF, Institute for Hormone and Fertility Research, University Hospital Hamburg-Eppendorf D-20251 Hamburg, Germany

Asian J Androl 2003 Dec; 5: 277-286


Keywords: epididymis; cDNA homology cloning; HE3-, HE4- and Ce8-homologous proteins
Abstract

Aim: Identification of the rodent counterparts of human and canine epididymal cDNAs HE3, HE4 and Ce8/Ly6G5C by sequence homology and analysis of their expression patterns and regulation level in the rat. Methods: "Electronic screening" of Expressed Sequence Tag (EST) and genomic databases, followed by RT-PCR and Northern blot analysis. Results: Rodent ESTs and genomic sequences homologous to HE3, HE4 and Ce8/Ly6G5C were identified in the public databases and the "full-length" rat cDNAs cloned. To emphasise their homology to the human and canine genes, they were named Me3/Re3, Me4/Re4 and Re8 for mouse and rat counterparts, respectively. mRNA expression patterns were analysed in rats, including rat HE1 and HE5/CD52 counterparts as controls. Re3 and Re8 mRNAs were only found in the rat epididymis, while Re4 showed a broader tissue distribution. Within the epididymis, Re3 and Re4 mRNAs were detected in all regions; Re8, on the other hand, was restricted to the caput. During postnatal development, Re3 and control mRNAs were found from the earliest stages investigated, while Re8 mRNA was observed only from day 24 postnatum, corresponding to the onset of spermatogenesis in the prepubertal testis. Castration and testosterone supplementation of adult male rats suggested that none of the cloned mRNAs was directly androgen-regulated. Efferent duct ligation, however, showed that Re8 mRNA levels depended on testicular factors other than androgens. Conclusion: The novel rodent cDNAs can now be used to monitor epididymal gene expression more closely and to set up various regulatory and functional studies.

1 Introduction

Sperm mature functionally during their transit through the epididymis and in the animal models studied, this organ appears to be essential for the acquisition of male in vivo fertilizing capacity. However, our understanding of epididymal functions on a molecular level is extremely limited and the mechanisms by which specific epididymal proteins are regulated and may support sperm fertilizing ability are largely unknown. It is, therefore, of interest to study which epididymal gene products are conserved among mammals and may play a common role. Approaches to directly study human epididymal functions are limited. Our group has achieved the cloning of a number of human epididymal gene products, named HE cDNAs [1], specifically or at least predominantly expressed in this tissue. In order to circumvent any problems that arise from species differences in epididymal gene expression our previous cloning strategy relied on the tissue-specificity and high frequency of certain human epididymal mRNAs only without any knowledge of related sequences from animal models. As a conse-quence, for most of the HE cDNAs, the corresponding rodent counterparts remained elusive. Instead, a similar appraisal of epididymis-specific gene expression was started in the dog [2], which represents a useful model with high similarity to the human on the molecular level. Canine counterparts of most HE cDNAs were readily identified by cross-hybridization, suggesting that they were both sufficiently similar and abundant [3]. Still, our understanding of how the HE proteins and their canine homologues are regulated and may implement sperm fertilizing ability is limited.

It has been suggested that present problems to link the expression of a specific epididymal protein to male fertility may be overcome in the future by the targeted disruption of the corresponding gene [4]. The molecular cloning of the rodent homologues of the HE genes, combined with a spatial and temporal expression analysis represents an important step in this direction. Given the phenomenal rate of nucleic acid sequence accumulation in the databases, the classical homology screening of cDNA libraries can now be transferred to an electronic level. The mouse counterpart of HE1 [5], named Me1 [6], was the first example of a successful homology cloning of an HE cDNA based on expressed sequence tag (EST) database searches. HE1 is the second gene of the Niemann-Pick type C disease, NPC2 [7], and encodes a highly conserved cholesterol transfer protein of mammalian epididymal fluid [8, 9]. The sequences of other HE cDNAs, in comparison, seemed to have diverged to a much greater extent and their rodent homologues are not easily found by standard homology screening procedures [5, 10].

In the present study, we aimed at the identification and molecular cloning of additional HE homologues in rodents. We focussed here on the counterparts of HE3 and HE4 [10, 11, 12] as well to the canine Ce8 [13] which is related to the human Ly6G5C gene [14]. Each of the predicted proteins is characterized by a distinct conserved cysteine pattern; however, sequences outside these patterns are quite divergent. Using our own published sequence information on HE3, HE4 and Ce8/Ly6G5C, the rodent EST and genomic databases were electronically screened and the most similar nucleic sequences compiled. The "full-length" rat cDNAs were cloned and employed as hybridisation probes to study the spatial and temporal expression patterns of the corresponding mRNAs in the rat epididymis.

2 Materials and methods

2.1 Animal tissues and experiments

Rat tissues were from adult male laboratory animals (Sprague Dawley male rats; Charles River) that had been killed by asphyxiation in CO2. For developmental studies, epididymides were obtained from young male rats, aged 15 days ~ 60 days, and tissues from three animals pooled for each experiment. For the various types of animal experiments, i.e. castration, castration plus testosterone supplementation, efferent duct ligation and sham operation, adult male rats (408 g ± 28 g body weight) were anaesthetised and operated as described [15]. Surgery was done in compliance with German Animal Welfare laws under licence 85/95. All animals were sacrificed two weeks after the operation. Epididymides as separated into caput, corpus and cauda regions and various control tissues were collected, shock-frozen in liquid nitrogen and stored at -80 . The Guiding Principles in the Care und Use of Laboratory Animals (DHEW Publication, NIH, 80-23) was observed in all cases.

2.2 RNA extraction, RT-PCR and Northern blot analysis

Total cellular RNA was extracted by standard procedures and complementary DNA (cDNA) synthesized as described [15] by oligo-(dT)-primed reverse transcription (RT) from 2 μg ~ 5 μg of total RNA per reaction using SuperscriptTM reverse transcriptase (GIBCO BRL, Karlsruhe, Germany). Sequences of primer pairs employed in RT-PCR procedures are shown in Table 1. Digoxigenin (DIG)-labelled cDNA probes were prepared as described [15] following the instructions of the supplier (Boehringer, Mannheim, Germany). After 3 min at 95 , the reactions were subjected to 3 cycles at each annealing temperature (58 , 56 , 54 and 52 , respectively) of denaturation, annealing and elongation (denaturation 1min at 95 ; annealing 1 min at 58 , 56 , 54 and 52 and elongation 1min 72 ). Subsequently, 28 cycles of denaturation (1 min at 95 ), annealing (1 min at 50 ) and elongation (1min at 72 ) were performed. Amplicons were separated and visualized on 1 % TAE agarose/ethidium bromide gels. Identity of inserts was confirmed by subcloning into the TA-cloning vector pGEM-T Easy (Promega) followed by plasmid DNA sequencing (MWG-Biotech, Ebersberg, Germany). Northern blot analysis was performed as described [16]. Briefly, 5 μg ~ 10 μg of total RNA per lane, depending on the type of experiment, were separated by denaturing agarose gel electrophoresis and transferred to Hybond N+ nylon membranes (Amersham, Braunschweig, Germany). Equal loading of RNA was ascertained by ethidium bromide staining of gels prior to blotting. Non-radioactive hybridization employing DIG-labelled cDNA probes, subsequent washing and signal detection reactions were performed following the recommendations of the supplier (Boehringer). Sequences of oligonucleotide primer pairs employed for the preparation of DIG-labelled probes are given in Table 1, upper lines. A DIG-labelled cDNA was prepared from rat-18S ribosomal RNA as a blotting control using the following primers: 5' -AGGACCGCGGTTCTATTTTGTTG-3'/5'-CGGGCCGGGTGAGGTTT-3' and a 60 ~ 50 "touch-down" PCR-program.

2.3 Generation of 5' and 3' cDNA ends

Partially cloned cDNA fragments were completed at their 5' ends by inverse RT-PCR as described [13]. Briefly, a gene-specific antisense primer was used for reverse transcription of 5 μg total rat epididymal RNA with SuperscriptTM reverse transcriptase (GIBCO BRL). Second strand synthesis was performed with E. coli DNA polymerase after nicking with RNase H (Stratagene, Heidelberg, Germany). Blunt ends were generated with T4 DNA polymerase (Biolabs, Schwalbach/Taunus, Germany) and ligated by T4 DNA ligase (Boehringer, Mannheim, Germany). Inverse PCR on circularized cDNA was then carried out using sense and antisense primers arranged in a back-to-back orientation opposite to that normally employed for conventional PCR. Sequences of oligonucleotide primer sets were as follows: Re3-primer set, 5'-Race primer: 5'-CTCTATGCTGTCGACATACC-3'; sense primer: 5'-AGATATACAGAGAGAAGGAGT-3'; antisense primer: 5'-CTGTCATGAGGACATCACAG-3'. Re8- primer set, 5'-Race primer: 5'-GCAGAAATCCAGGAAGC-3'; sense primer: 5'-GGATATTCTATCAGTGC-3'; antisense primer: 5'-CTCCAG-CAGACATCGGTAG3'. Generation of 3'-ends was performed according to standard techniques as described [10].

Sequences of the gene-specific oligonucleotide primers (GS primers) employed were: Re3-GS primer: 5'-CCACTGCAATGCTGATGG-3'; RE4-GS primer: 5'-CAACTACAAGTGCTGCCAG-3'; RACE1-Primer: 5'-GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT-3'; RACE2-Primer: 5'-GACTCGAGTCGACATCG-3'. cDNA sequences were compiled using the DNASTARTM software package. The predicted "gull-length" rat cDNA sequences were confirmed by RT-PCR employing specific pairs of "full-length" primers, respectively (Table 1). Amplicons of rat cDNAs were subcloned and sequenced by cycle sequencing (MWG).

Table 1. Primer sequences employed for standard RT-PCR procedures.

Name of cDNA clone

Primer sequence (sense/antisense)

Accession No.

Fragment length

Annealing temp. 
(TD =touch down)

Me1/Re1

  Me1/Re1 „full length”

ATGCGTTTCCTGGCAGCTACATTCC/CGATCTGTACTGGGATTTCCCA

TGCTTTCCCTTCCTAGATTG/GCAACCAAGTATTGGCTTT

 

  AB021289

442bp 

1120bp

 

  55°C

Me3/Re3

  Me3/Re3 „full length”

AACTGTGATGTCCTCATGAC/CTCTATGCTGTCGACATACC

ACGTGGGCACTGGTTGGGTG/CCTGGATAAGTCAAGAGAAGATGC

W41774

  BC031737

265 bp

 1122 bp

TD 58°C-50°C

  TD 64°C-56°C

Me4/Re4

Me4/Re4 „full length”

CAACTACAAGTGCTGCCAG/GAAAGCGATCACTTTATTGG

ATGCCTGCCTGTCGCCTC/AGCGATCACTTTATTGGTTAGAA

  AI4115270 and AK005519

497 bp

662 bp and 489 bp

TD 58°C-50°C

50°C

Me8/Re8

Me8/Re8 „full length”

TGCTACCGATGTCTGCTG/GCAGAAATCCAGGAAGC

CATGTCAGGCCTTGCAGCCA/GCATACTGTTTTATTTTGG

 

  AF109905

234 bp

 669 bp

 

TD 60°C-50°C 

3 Results

3.1 Identification and cloning of HE1-, HE3-, HE4- and HE8/Ce8-homologous cDNAs

Mouse and rat EST sequences aligning with HE1, HE3, and HE4 [5, 10, 11] were identified in the public domain databases by the blastn and tblastn search modus [17]; for accession numbers, see Table 1. Based on this information, oligonucleotide primers for RT-PCR amplification from rat epididymal RNA extracts were designed. A Re1 amplicon of 1120 nucleotides was cloned by standard RT-RCR followed by anchor 3'-RACE and its identity confirmed by sequence analysis (accession No. AJ515237). Within its coding region, Re1 showed 83% identity with HE1 [5] and 92 % identity with Me1 [6]. The long rodent 3'-UTR, however, showed no similarity to the HE1 mRNA which contains a much shorter 3'-UTR (accession No. NM-006432). The results described by Nakamura et al. [6] suggested that the rodent genes comprised 4 exons, a major part of the Me1 and Re1 ORFs as well as their entire 3'-UTRs encoded in a single large exon. The human HE1 gene (accession No. NM-006432) consists of five exons instead. Thus, an additional splicing event may have led to an abridged 3'-UTR in the human (compare [5]).

In the case of the rodent HE3- and HE4-homologues, the public EST information was less complete (for accession No., see Table 1). Partial cDNAs were cloned, completion of their 5'-ends approached by inverse RT-PCR [13], and completion of 3'-ends achieved by 3'-RACE (see Materials and Methods). "full-length" Me3 and Re3 cDNAs of 1200 nucleotides were compiled and the Re3 cDNA cloned (accession No. AJ515238). Overall sequence identity between Me3 and Re3 was approximately 70 %. Sequence identity with the human HE3alpha and beta cDNAs was only 50 % on the nucleic acid level, explaining the lack of cross-species hybridisation observed in previous Northern analyses [10]. Different from the human, in which HE3 represents a gene family of at least 4 members located on chromosome 14, a single genomic sequence was assigned in the mouse genome within a region on chromosome 14, which is syntenic with the human chromosome 14 (UCSC browser, release April 2003). Alignments with the corresponding human and mouse genomic sequences suggested that an "upstream" exon existed, encoding the proximal most part of the 5'-UTR of Me3 and Re3. This sequence, however, is still unaccounted for.

Rodent cDNAs homologous to the human HE4 [11] and the canine Ce4 [18] were identified by the same approach (for accession nos. of ESTs, see Table 1). Two different cDNAs were amplified from rat epididymal RNA extracts, named Re4 variant 1 and 2 (accession nos. AJ515239 and AJ515241). The shorter cDNA most probably derived from an mRNA splice variant (compare [12]). While Me4 and Re4 "full-length" cDNA sequences were nearly 77 % identical, their overall sequence identity to HE4 and Ce4 was less than 60 %. This modest co-linearity was due to a large insertion within the rodent cDNAs. According to the mouse genomic sequence (UCSC Genome Browser, release February 2003) this insertion is encoded by an additional exon, which is not conserved in the human HE4 gene.

The Ce8 mRNA is highly abundant in a small region of the canine caput epididymidis [3, 13]. Unexpectedly, the corresponding human epididymal cDNA, "HE8" was extremely rare and lacked an ORF (own unpublished results). Therefore, the Rhesus monkey, Macaca mulatta, was included here as a primate model. Based on the human genomic sequence, the macaque epididymal cDNA, RHe8 (accession No. AJ560720), was obtained, which is >90 % identical with the human Ly6G5C sequence. Interestingly, no related mouse ESTs were identified in the public databases either, although a closely related mouse genomic sequence exists (accession No. AF 109905). Based on this sequence, RT-PCR and RACE experiments were performed with cDNAs from mouse and rat epididymides. The experiments resulted in the amplification of an abundant rat cDNA, named Re8 (accession No. AJ515240), while the mouse epididymal cDNA remained elusive. The Re8 cDNA was approximately 60 % identical to Ce8 [13] as well as to RHe8.

3.2 Characterization of predicted rat epididymal (Re) protein products

All cDNA sequences predicted small proteins, ranging from 130 (Re1) to 168 (Re4) amino acids in length (Figure 1 a-d). Each ORF contained two closely adjacent in-frame ATG codons, thus it was not possible to define the precise translation starts by extrapolation. However, typical cleavable signal peptides were unambiguously predicted (SignalP [19]) suggesting that the proteins would enter the secretory pathway. Amino acid alignments of the mammalian HE1 counterparts (Figure 1a) showed a high degree of sequence conservation, including a V- (X)1-5-(X)1-5-K cholesterol recognition/interaction consensus [20], which is redundant in the rodent sequences. Three N-X-T-sequons are predicted, two of which are conserved and appeared to be N-glycosylated like in Me1 [6] (Figure 1a).

Figure 1. Primary structure of rodent HE-homologous proteins as predicted from cDNAs (amino acid sequence given in one-letter code) and aligned with known mammalian species counterparts. (a) Me1/Re1 (accession No. AJ515237) cholesterol transfer protein; redundant putative cholesterol recognition/interaction consensus [20] underlined; (b) Me3/Re3 (AJ515238) showing significant similarity to RNase superfamily; (c) Me4/Re4, variant 1 (AJ515239) comprising two WAP domains separated by rodent-specific "linker" (d) Re8 (AJ515240) similar to Ly-6 domain proteins. Sequences were aligned for maximal homology; dashes have been allowed to improve alignment. Amino acid residues identical in all species are shown on a grey background; sequence differences between rodents and other mammals are high lightened by white background; conserved cysteine residues are accentuated by stars.

The peptide sequences predicted by the Me3/Re3, Me4/Re4 and Re8 cDNAs, in comparison, were less well conserved. Still, protein sequence alignments (Figure 1b-d) and tissue distributions of mRNAs (see below) showed significant similarities to the human and canine counter-parts, which argue in favour of their evolutionary relationship and their genomic loci, as far as already known, point into the same direction. Me3 and Re3 predicted non-glycosylated proteins with significant similarity to the RNase superfamily (Figure 1b). Both were more similar to the human HE3beta isoform and the porcine Se3 protein [21] than to the human HE3alpha isoform [10]. Me4 and Re4 cDNAs predicted secretory proteins with one or two whey acidic protein (WAP) or elafin domains (Figure 1c), similar to the known HE4 species counterparts [11, 12, 18, 21]. The predicted "full-length" rodent isoforms were considerably longer than the counterparts in other species, including HE4, due to peptide "linkers" separating the WAP domains (Figure 1c). These linkers comprised 46 amino acids in the rat and 52 amino acids in the mouse. They were predicted to be highly O-glycosylated (NetOGlyc, [22]). Comparable motifs are not found in the human, canine, rabbit and porcine homologues (Figure 1c). The shorter Re4 variant predicted an isoform which lacked the first WAP domain but still contained the linker peptide followed by the second WAP domain. Additional isoforms as described in the mouse [12] were not identified in the rat epididymis; still, they may well exist.

Re8 contained a conserved cysteine pattern with significant similarities to the Ly-6 domain proteins (Figure 1d). However, a C-terminal GPI-anchoring signal, which is present in many other Ly-6 domain proteins (compare [23]), was lacking and a putative N-terminal signal peptide was unusually long. While the single Ly-6 domain of Re8 and Ce8 [13] was well conserved (Figure 1d), their N-terminal sequences were divergent. Highest variation was observed within a region where multiple splice variants are found in Ce8 and the human LY6G5C [13, 14].

3.3 Tissue distribution and developmental expression pattern of Re mRNAs

Northern blot analysis was performed in the rat employing DIG-labelled cDNA fragments as non-radioactive hybridization probes. Comparing eight different rat tissues, Re3 and Re8 mRNAs were only detected in the epididymis (Figure 2a, b). Their lengths of 1.3 kb and 0.7 kb, respectively, were in good agreement with the lengths of the corresponding Re3 and Re8 cDNA sequences (compare AJ515238 and AJ515240). The Re4 mRNA, however, was not restricted to the rat epididymis, but showed a broader tissue distribution. Rather, epididymal mRNA levels were comparably weak and only observed after overexposure (Figure 2c). Much stronger Re4 hybridisation signals were obtained with RNA extracts from rat liver, lung and kidney. The diffuse appearance of the hybridizing bands ranging from 0.6 to 0.7 kb in length suggested that more than one mRNA splice variant was present in liver and kidney (compare [12]).

Figure 2. Tissue distribution of Re mRNAs as revealed by Northern blot analysis. Re3 (a) and Re8 (b) hybridization signals were only obtained with epididymal RNA (Ep; upper panels). Re4 mRNA (c) showed a broader tissue distribution, including a faint hybridization signal on epididymal RNA (lower panel). Ep = epididymis; Va = Vas deferens; Ki = kidney; Li = liver; Se = seminal vesicles; Pr = prostate; Lu = lung; Ov = ovary; He = heart; Te = testis; Br = brain; Mu = muscle; Sp = spleen. Approximately 10 μg of total rat RNA extracts from different tissues were loaded per lane; equal loading and integrity of RNA was controlled by ethidium bromide staining and hybridization with a 18S rRNA probe (lower panels). (d) Rhe8/Ly6G5C mRNA in the epididymis of Macaca mulatta. Employing a DIG-labelled HE8 hybridization probe, a signal was only seen with monkey caput epididymidal RNA, but not with human (upper panel). Te = testis; Ca = caput epididymidis; Co = corpus epididymidis; Cu = cauda epididymidis; Vas = Vas deferens. Approximately 10 μg of epididymal RNA extracts from subsequent regions were loaded per lane; equal loading and integrity of RNA was controlled by ethidium bromide staining of 28S and 18S rRNA (lower panel).

The identification of an abundant epididymis-specific Re8 mRNA in the rat was congruent with our previous findings in the dog [13], but different from our results in the human and the mouse. Based on the oligonucleotide primers for the human Ly6G5C sequence [14], a DIG-labelled "HE8" cDNA fragment was amplified for use as a primate hybridization probe. No signal was observed with human epididymal RNA, but a cross-hybridizing macaque epididymal mRNA of 0.7 kb was readily observed on the same blot (Figure 2d).

Temporal expression patterns of Re1, Re3, Re5/CD52 and Re8 mRNAs were studied in the developing rat epididymis employing homologous DIG-labelled cDNA probes (Figure 3). Re4 mRNA levels were below the detection limit in this experiment. Re1, Re3, and Re5/CD52 mRNAs were detected at increasing levels from the earliest stages of postnatal development throughout the peri-pubertal and adult stages. The Re8 mRNA, in comparison, was observed at Northern detectable levels only from days 24 to 28 of postnatal development, approximately corresponding to the time point of onset of spermatogenesis in the pubertal rat testis.

Figure 3. Increase in rat epididymides of Re mRNA levels during post-natal development. Re1 and Re5/CD52 mRNAs were included in a Northern analysis as controls (upper panel). Similarly, Re3 mRNA levels increased gradually from day 15 (15 d) of post-natal development into adulthood (60 d; second panel) while Re8 mRNA was detectable only from days 24 to 28 post-natum (24 d, 28 d) into adulthood (third panel). Approximately 10 μg of pooled rat total epididymal RNA extracts were loaded per lane; equal loading and integrity of RNA was controlled by hybridization with an 18S rRNA probe (lower panel).

3.4 In vivo regulation of Re mRNAs as revealed by various types of animal operations

Androgen modulation of Re mRNAs was investigated by castration of adult male rats with and without androgen supplementation and compared to sham-operated controls (Figure 4). As rodent epididymal mRNA expression is strictly region-dependent and the effects of castration and androgen supplementation depend on the epididymal region studied [24], epididymides of operated animals were separated into caput, corpus and cauda regions prior to Northern blot analysis. Caput and corpus levels of the "short" Re5/CD52 mRNA species are known to be modulated by androgens [15]. They were dramatically reduced after castration and restored to normal in the testosterone-supplemented animals (Figure 4), thus serving as a positive control and confirming an androgenic effect. Likewise, caput Re1 mRNA levels were reduced by castration and restored by testosterone supplementation. Different from these controls, castration and testosterone supplementation had hardly any effects on Re3 mRNA levels in either region of the rat epididymis (Figure 4). The same appeared to apply to the Re4 mRNA although these bands as a consequence of the comparably low expression in the rat epididymis were difficult to discern.

Figure 4. Effect of castration and testosterone supplementation in adult males on Re mRNA levels as revealed by Nothern blot analysis. Pooled RNA extracts from subsequent epididymal regions after different treatments (castration, castration plus testosterone supplementation, sham-operated control) were loaded. Ca = caput epididymidis; Co = corpus epididymidis; Cu = cauda epididymidis. While Re1 and Re5/CD52 mRNA levels reflected the anticipated androgenic effects, Re3 and Re4 mRNA levels appeared to be barely effected by either type of operation. Re8 mRNA was completely abolished by castration and not restored by androgen supplementation. Approximately 10 μg of total RNA extracts were loaded per lane; equal loading and integrity of RNA was controlled by hybridization with an 18S rRNA probe (lower panel).

Re8 mRNA expression, on the other hand, was highly region-dependent and only observed in the caput region of sham-operated controls. It was completely abolished by castration (Figure 4). A very faint 0.7 kb-band was seen in the testosterone-supplemented animals showing that androgen supplementation was not sufficient to restore Re8 mRNA levels and suggesting that Re8 expression depended largely on testicular factors other than androgens. This assumption was corroborated by the complete absence of Re8 mRNA after unilateral ligation or cutting of efferent ducts (Figure 5).

Figure 5. Effect of unilateral and bilateral efferent duct ligation and dissection in adult males on Re8 mRNA levels as revealed by Nothern blot analysis. No Re8 mRNA was detectable in caput region after these treatments. Lane 1: unilateral ligation, untreated side; Lane 2: unilateral ligation, ligated side. Lane 3: unilateral dissection, untreated side; Lane 4: unilateral dissection, dissected side. Lanes 5 and 6: bilateral dissection. Lane 7: untreated control rat. Approximately 10 μg of total RNA extracts were loaded per lane; equal loading and integrity of RNA was controlled by ethidium bromide staining and/or by hybridization with an 18S rRNA probe (lower panel).

4 Discussion

"Electronic homology screening" of databases, relying on nucleic acid and/or peptide sequence conservation, was applied in this study to identify the rodent counterparts of the previously described human and canine HE3, HE4 and Ly6G5C/Ce8 cDNAs [10, 11, 13]. To emphasize their evolutionary relationship, we tentatively named the rodent homologues Me3/Re3, Me4/Re4 and Re8, although the tissue distribution of the rat Re4 mRNA was not congruent to HE4 and Ce4. Still, a sufficiently high degree of sequence conservation was revealed, adding to the number of abundant rodent epididymal markers with relevance to the human. In comparison, the rodent homologues of HE5/CD52 [25] have diverged to a much greater extent and differ significantly from the human sequence [26, 27]. Likewise, the anti-microbial peptide-encoding HE2 [28] is poorly conserved, and its rat counterpart was identified only recently by features other than sequence homology [20, 29].

The individual rodent gene probes described here can now be used in microarrays to monitor the differences in epididymal gene expression more closely which are provoked by various types of operations or by the disruption of genes with regulatory functions. Access to these cDNAs also offers the possibility of recombinantly expressing the predicted proteins and to include them in functional tests. Sequence similarities to proteins of known functions predict that the molecules might have a role in genital tract and sperm protection. The deduced Re3 and Me3 proteins show significant similarities to extra-cellular RNases (SMART, [30]) that have been shown to represent a novel class of secreted antimicrobial proteins [31]. Interestingly, both the human and mouse genes are located on chromosome 14 within a region where numerous members of the RNase superfamily genes are found. It is thus consistent to set up functional tests to find out whether the Me3/Re3 proteins may exhibit RNase and/or antimicrobial activity.

Me4/Re4 mRNAs predict small secretory proteins with WAP or elafin domains. A recent publication underscores the role of the WAP domain as an important skeletal motif to form antibacterial proteins [32]. While HE4 is mainly expressed in the human epididymis [11, 33] the Re4 mRNA is expressed at high levels in rat liver, lung and kidney and only at lower levels in the rat epididymis, suggestive of a more general function of the encoded protein. A structurally related rodent protein with a similar tissue distribution, SLPI, showed both antibacterial and antiprotease activity and its role in innate immunity is currently under intense investigation [34]. HE4, SLPI and several other WAP motif proteins (WAP1, elafin, eppin, C20orf170, LOC164237 and WFDC3) form a gene cluster on human chromosome 20, suggesting that they may be derived from the same ancestral gene by gene duplication [33].

Like the canine Ce8 mRNA [13], the Re8 cDNA sequence predicts a small lymphocyte antigen-6 (=Ly-6) domain protein, which is related to a human gene, named Ly6G5c [14]. Most of the known Ly-6 superfamily proteins have definite or putative immune related roles. Surprisingly, the homologous mouse epididymal mRNA remained elusive, just like the tentative human "HE8" mRNA. Closely related human and mouse genes, how-ever, are located on chromosome 6 within the major histo-compatibility complex class III regions (accession No. AJ315552) as part of a cluster of genes encoding potential Ly-6 superfamily members.

Targeted mutagenesis has successfully been applied in mice in many cases and very recently was also shown to work in rats [35]. It would thus appear a suitable approach to elucidate the function(s) of genes specifically expressed in the epididymis [4]. The results presented here are prerequisite for this approach. A notable caveat, however, must be raised for the genes described in this study. This is most obvious in the case of the Ly6G5C/Ce8 gene. Epididymis-specific Ly6G5Crelated mRNAs were only observed in the rat and in the rhesus monkey. Mice (and human males!) do not seem to express detectable amounts of this mRNA in their epididymides and thus may already be regarded as "functional conditional Ly6G5C knockouts". Any consequences of the absence of this mRNA are unknown. It is tempting, however, to speculate that different mammalian species might express different members of the Ly-6 superfamily of proteins in their epididymides.

Another caveat must be raised, if the gene of interest which is going to be disrupted is expressed and essential elsewhere in the body. In this case, strategies for a conditional inactivation will have to be developed (for review, see [36]). For example, HE1/NPC2 encodes an abundant cholesterol transfer protein of epididymal fluid [9]. The NPC2 disease type which ablates the HE1 gene in all cells of the body is characterized by a fatal ubiquitous block in cholesterol sterification [6]. Thus, it could be that a conventional "knockout" approach is not feasible in the case of Me1 and a strategy of conditional gene inactivation will have to be developed in order to study its function in the epididymis. The broader tissue distribution of Re4 (this study) and Me4 [12] would likewise argue against a conventional knockout approach. On the other hand, considering that HE4 (and possibly also its rodent counterparts) are members of a whole cluster of functionally related genes [33], its function may be redundant.

Among the rodent genes whose mRNA expression was studied here, only Me3/Re3 seemed to represent a candidate gene for a conventional knockout approach. The mRNA appeared to be restricted to the epididymis, at least when studied in the adult rat. Still, it cannot be excluded that it may be expressed at low levels elsewhere in the body (compare [14]) at earlier developmental stages. The presence in the databases of Me3-related ESTs (e.g. accession No. W77565) from early mouse embryos raises the possibility that an ablation of the Me3 gene might compromise steps of early development. However, new tools for temporal, spatial and cell-type-specific control of gene expression are now available for the study of transgene action in mice. The universal design of the core transgenic construct described by Utomo et al [36] will possibly allow the establishment of analogous mouse strains with an epididymis-specific promoter as systems to unravel protein function in this organ.

Acknowledgements

We are indebted to Drs. Ching-Hei Yeung and Trevor G. Cooper, IRM, University of Münster, Germany, who generously provided the tissues from operated male rats included in this study. We also gratefully acknowledge the help of Dr Ilka Kascheike, IHF, during the initial cloning and hybridisation experiments of this study. We thank Ms Beate Harms, IHF Hamburg, for excellent technical assistance. The study was supported by Deutsche Fors-chungsgemeinschaft (DFG), grant contract No. KI 317/8-1.

References

[1] Kirchhoff C. Specific gene expression in the human and non-human primate epididymis. In: Robaire B, Hinton B, editors. The Epididymis ?From Molecules to Clinical Practice. New York: Kluwer Academic/Plenum Publishers; 2002a. p 201-18.
[2] Ivell R, Pera I, Ellerbrock K, Beiglbock A, Gebhardt K, Osterhoff C, et al. The dog as a model system to study epididymal gene expression. J Reprod Fertil Suppl 1998; 53: 33-45.
[3] Kirchhoff C. The dog as a model to study human epididymal function at a molecular level. Mol Hum Reprod 2002b; 8: 695-701.
[4] Lye RJ, Hinton BT. Transgenic technologies for the study of epididymal function. Asian J Androl 2000; 2: 33-8.
[5] Kirchhoff C, Osterhoff C, Young L. Molecular cloning and characterization of HE1, a major secretory protein of the human epididymis. Biol Reprod 1996; 54: 847-56.
[6] Nakamura Y, Takayama N, Minamitani T, Ikuta T, Ariga H, Matsumoto K. Primary structure, genomic organization and expression of the major secretory protein of murine epididymis, ME1. Gene 2000; 251: 55-62.
[7] Naureckiene S, Sleat DE, Lackland H, Fensom A, Vanier MT, Wattiaux R, et al. Identification of HE1 as the second gene of Niemann-Pick C disease. Science 2000; 290: 2298-301.
[8] Ko DC, Binkley J, Sidow A, Scott MP. The integrity of a cholesterol-binding pocket in Niemann-Pick C2 protein is necessary to control lysosome cholesterol levels. Proc Natl Acad Sci U S A 2003; 100: 2518-25.
[9] Okamura N, Kiuchi S, Tamba M, Kashima T, Hiramoto S, Baba T, et al. A porcine homolog of the major secretory protein of human epididymis, HE1, specifically binds cholesterol. Biochim Biophys Acta 1999; 1438: 377-87.
[10] Kirchhoff C, Pera I, Rust W, Ivell R. Major human epididymis-specific gene product, HE3, is the first representative of a novel gene family. Mol Reprod Dev 1994; 37: 130-7.
[11] Kirchhoff C, Habben I, Ivell R, Krull N. A major human epididymis-specific cDNA encodes a protein with sequence homology to extracellular proteinase inhibitors. Biol Reprod 1991; 45: 350-7.
[12] Bingle L, Singleton V, Bingle CD. The putative ovarian tumour marker gene HE4 (WFDC2) is expressed in normal tissues and undergoes complex alternative splicing to yield multiple protein isoforms. Oncogene 2002; 21: 2768-73.
[13] Gebhardt K, Ellerbrock K, Pera I, Ivell R, Kirchhoff C. Differential expression of novel abundant and highly regionalized mRNAs of the canine epididymis. J Reprod Fertil 1999; 116: 391-402.
[14] Mallya M, Campbell RD, Aguado B. Transcriptional analysis of a novel cluster of LY-6 family members in the human and mouse major histocompatibility complex: five genes with many splice forms. Genomics 2002; 80: 113-23.
[15] Pera I, Derr P, Yeung CH, Cooper TG, Kirchhoff C. Regionalized expression of CD52 in rat epididymis is related to mRNA poly(A) tail length. Mol Reprod Dev 1997; 48: 433-41.
[16] Pera I, Ivell R, Kirchhoff C. Body temperature (37
) specifically down-regulates the messenger ribonucleic acid for the major sperm surface antigen CD52 in epididymal cell culture. Endocrinology 1996; 137: 4451-9.
[17] Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997; 25: 3389-402.
[18] Ellerbrock K, Pera I, Hartung S, Ivell R. Gene expression in the dog epididymis: a model for human epididymal function. Int J Androl 1994; 17: 314-23.
[19] Nielsen H, Engelbrecht J, Brunak S, von Heijne G. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng 1997; 10: 1-6.
[20] Li H, Papadopoulos V. Peripheral-type benzodiazepine receptor function in cholesterol transport. Identification of a putative cholesterol recognition/interaction amino acid sequence and consensus pattern. Endocrinology 1998; 139: 4991-7.
[21] Schäfer B, von Horsten H, Dacheux J, Holtz W, Kirchhoff C. Cloning and characterization of boar epididymal secretory proteins by homology to the human. Reprod Domest Anim 2003; 38: 111-8.
[22] Hansen JE, Lund O, Nilsson J, Rapacki K, Brunak S. O-GLYCBASE Version 3.0: a revised database of O-glycosylated proteins. Nucleic Acids Res 1998; 26: 387-9.
[23] Palfree RG. Ly-6-domain proteins--new insights and new members: a C-terminal Ly-6 domain in sperm acrosomal protein SP-10. Tissue Antigens 1996; 48: 71-9.
[24] Orgebin-Crist MC. Androgens and epididymal functions. In: Bhasin S, et al. editors. Pharmacology, Biology, and Clinical Applications of Androgens. Wiley-Liss Inc.; 1996. p27-38.
[25] Kirchhoff C, Krull N, Pera I, Ivell R. A major mRNA of the human epididymal principal cells, HE5, encodes the leucocyte differentiation CDw52 antigen peptide backbone. Mol Reprod Dev 1993; 34: 8-15.
[26] Kirchhoff C. A major messenger ribonucleic acid of the rodent epididymis encodes a small glycosylphosphatidylinositol-anchored lymphocyte surface antigen. Biol Reprod 1994; 50: 896-902.
[27] Kirchhoff C. CD52 is the 'major maturation-associated' sperm membrane antigen. Mol Hum Reprod 1996; 2: 9-17.
[28] von Horsten HH, Derr P, Kirchhoff C. Novel antimicrobial peptide of human epididymal duct origin. Biol Reprod 2002; 67: 804-13.
[29] Yamaguchi Y, Nagase T, Makita R, Fukuhara S, Tomita T, Tominaga T, et al. Identification of multiple novel epididymis-specific beta-defensin isoforms in humans and mice. J Immunol 2002; 169: 2516-23.
[30] Schultz J, Copley RR, Doerks T, Ponting CP, Bork P. SMART: a web-based tool for the study of genetically mobile domains. Nucleic Acids Res 2000; 28: 231-4.
[31] Harder J, Schroder JM. RNase 7, a novel innate immune defense antimicrobial protein of healthy human skin. J Biol Chem 2002; 277: 46779-84.
[32] Hagiwara K, Kikuchi T, Endo Y, Huqun UK, Takahashi M, Shibata N, et al. Mouse SWAM1 and SWAM2 are antibacterial proteins composed of a single whey acidic protein motif. J Immunol. 2003; 170: 1973-9.
[33] Clauss A, Lilja H, Lundwall A. A locus on human chromosome 20 contains several genes expressing protease inhibitor domains with homology to whey acidic protein. Biochem J 2002; 368 (Pt 1): 233-42.
[34] Nakamura A, Mori Y, Hagiwara K, Suzuki T, Sakakibara T, Kikuchi T, et al. Increased susceptibility to LPS-induced endotoxin shock in secretory leukoprotease inhibitor (SLPI)-deficient mice. J Cell Biol 2003; 197: 669-74.
[35] Zan Y. Production of knockout rats using ENU mutagenesis and a yeast-based screening assay. Nat Biotechnol 2003; 21: 645-51.
[36] Utomo AR, Nikitin AY, Lee WH. Temporal, spatial, and cell type-specific control of Cre-mediated DNA recombination in transgenic mice. Nat Biotechnol 1999; 17: 1091-6.


Correspondence to: Dr. C. Kirchhoff, IHF Institute for Hormone and Fertility Research, Falkenried 88, D-20251 Hamburg, Germany.
Tel: +49-40-42803-1560, Fax: +49-40-42803-1599/-1699
E-mail: kirchhoff@ihf.de
Received 2003-07-03 Accepted 2003-09-15