Editor-in-Chief |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Clinical and pathological correlation of the microdeletion of Y chromosome for the 30 patients with azoospermia and severe oligoasthenospermia Han-Sun Chiang1,2, Shauh-Der Yeh2,3, Chien-Chih Wu2,3, Boo-Chung Huang3, Hui-Ju Tsai2, Chia-Lang Fang4 1College of
Medicine, Fu Jen Catholic University, Taipei, China Asian J Androl 2004 Dec; 6: 369-375 Keywords: chromosome deletion; male infertility; azoospermia factor; azoospermia; oligoasthenospermia; Y chromosomeAbstractAim: To review the accumulated 30 patients with different area of Y chromosome microdeletions, focusing on their correlation with the clinical and pathological findings. Methods: A total of 334 consecutive infertile men with azoospermia (218 patients) and severe oligoasthenospermia (116 patients) were screened. Complete physical and endocrinological examinations, general chromosome study and multiplex polymerase chain reaction assay to evaluate the Y chromosome microdeletion were performed. Ten patients received testicular biopsy. Then the clinical and pathological findings were analyzed with reference to the areas of Y chromosome microdeletion. Results: There is a decline of the percentage of sperm appearing in semen in the group that the gene deletion region from AZFc to AZFb. The clinical evidence of the impairment (decreased testicular size and elevated serum FSH) is also relevantly aggravated in this group. However, the pathology of testicular biopsy specimen was poorly correlated with the different deletion areas of the Y chromosome, which may be due to the limited number of specimens. Conclusion: The clinical correlation of spermatogenic impairment to the different AZF deletion regions may provide the information for the infertile couples in pre-treatment counseling. 1 Introduction Y chromosome microdeletion have been identified in 9 % of azoospermia and 11.6 % of severe oligoastheno-spermia infertile patients [1] . Up to date, exactly how these microdeletions cause azoospermia or oligoastheno-spermia remains a subject of debate [2, 3]. In previous reports [4-6], examination of testis biopsy sample from azoospermia patients with different intervals of AZF (azoospermia factor) deletions revealed substantial variations, from Sertoli cell only to hypospermatogenesis. In the present study the accumulated 30 patients with AZF deletions were reviewed, focusing on their correlations with the clinical and pathological findings. For genetic counseling, these information will be related to the final decision of the patients undergoing the procedure of microscopic testicular sperm extraction and intracytoplasmic sperm injection (ICSI) [7]. 2 Materials and methods 2.1 Patients and examination From November 1997 to March 2001, a total of 334 consecutive men with azoospermia (218 patients) and severe oligoasthenospermia (116 patients) aged 19 - 65 years entered this study after fully consent. Semen analysis was performed by computer-aided sperm analysis (CASA) and further confirmed with repeated microscopic examinations by the same technician. The diagnosis of severe oligoasthenospermia was made with either very low sperm concentration (severe oligozoospermia) or very low sperm motility (severe asthenozoospermia) or both. We defined the sperm count less than 106/mL as the severe oligozoospermia and the motile sperm less than 10 % as the severe asthenozoospermia. The morphology of the sperm should be essentially normal (>60 % with normal morpgology). All of the patients underwent a comprehensive clinical examination, including a detailed history taking and physical examination, with special care to the testicular size. We measured the long axis of the testes. The criteria of the normal size of testicle in oriental Taiwanese was defined as more than 2.5 cm [8]. Usually, when the size of the palpable testis was less than 1 cm (peanut size), it could be diagnosed as testicular atrophy. We also noted that the spermatogenesis might be impaired when the long axis of bilateral testicles in between 1 - 2.5 cm [9]. A total of 218 patients had clinically non-obstructive azoospermia. Each patient was carefully examined to rule out prominent obstructive evidence. Endocrinology profile performed included luteinizing hormone (LH), follicule-stimulating hormone (FSH), prolactin and total testosterone. Elevated serum gonadotropins (in our standard value: LH > 12 mIU/mL, FSH > 15 mIU/mL) indicated the evidence of primary testicular insufficiency [8, 9]. In this study, we specially defined the elevated FSH (> 15 mIU/mL) as the laboratory evidence of germ cell dysfunction and might indicate impaired spermatogenesis. 2.2 Testicular biopsy Testis biopsy was done by the procedure of seminiferous tubule microdissection with testicular sperm extraction [10]. Under the direct optic magnification (?-8), the tunica albuginea of the testis was opened widely near its midportion to optimize visualization of the testicular parenchyma. individual seminiferous tubule was identified at ×20 - 25 magnification under the operating microscope. We evaluated at least 8 areas of the testicular parenchyma and selected the larger 4 more opaque tubules in each area as the samples for excision. The microdissected samples were sent to the laboratory for further cut and sperm extraction. Part of the specimen was prepared for pathological examination. 2.3 Pathological examination After fixation, paraffin-embedded sections (5 µm) was stained and examined under a light microscope at 400× magnification by the same pathologist. We routinely examined at least 32 tubules and counted every cell per tubule before categorizing. The histopathological classification of spermatogenesis impairment was divided into four categories: 1. Fibrotic change
(testicular atrophy). 2.4 Chromosome examination Whole blood was collected and plasma prepared with heparinized tube. The blood cells were cultured in RPMI-1640 with Phytohemagglutinin (PHA) for 72 hour at 37 ℃. Colcemid was added half an hour before harvest. The cultured blood cells were lysed and fixed by hypotonic solution (0.075 mol/L potassium chloride) and Carnoy's fixative. The cell suspension was spread in glass slides and then air-dried. The metaphase chromosomes were stained using the Trypsin-Giemsa band method. Twenty metaphase cells per slide were counted using a bright field microscope. If any anomaly in sex chromosome was suspected, 50 more cells were counted on each slide. 2.5 Detection of gene deletion in Yq chromosome Genomic DNA was extracted and amplified using a polymerase chain reaction (PCR)-based assay to evaluate the microdeletion in Y chromosome. To perform the molecular analysis, DNA was isolated. Five milliliters of fresh venous blood collected in ethylenediamine tetraacetic acid (EDTA) was centrifuged at 3 000 rpm for 5 min. The buffy coat was washed in erythrocyte lysis buffer (0.15 mol/L of NH4Cl; 0.01 mmol/L of Na2EDTA; 0.01 mol/L of KHCO3; pH 7.3); the resulting leukocytes were supplemented with 3 mL white cell lysis buffer (0.2 mol/L of Tris; 0.1 mol/L of EDTA; 1 % SDS) and were incubated at 60 ℃ for 1-2 h, or overnight at room temperature. One mL 10 mol/L NH4OAc was added and the sample was vortexed and pelleted. The clear supernatant was extracted once with isopropanol; DNA was precipitated with 2 volumes of ethanol, washed in 70 % ethanol and dissolved in distilled water. Multiplex PCR amplification of genomic DNA was carried out using a combination of the oligonucleotide primers (Invitrogen, USA): sY95 (primer A: tcctacagatgtccaaagtgc; primer B: gatgagtgaccccagaattg), sY117 (primer A: gttggttccatgctccatac; primer B: cagggagagagccttttacc), sY159 (primer A: tacatgttatgtgctatgcc; primer B: cacattatataatatgtatgttgtc), sY127 (primer A: gagagtcataatgccgacgt; primer B: tggtctcaggaagtttttgc), sY153 (primer A: gcatcctcattttatgtcca; primer B: caacccaaaagcactgagta), sY274 (primer A: ttaaggggacagtatttcaacttc; primer B: ccacatttaaactgagtacagtcc), sY277 (primer A: gggttttgcctgcatacgtaatta; primer B: cctaaaagcaattctaaacctccag), sY276 (AMELY) (primer A: cctaccgcatcagtgaatttc; primer B: tctgtatgtggagtacacatgg), sY81 (primer A: aggcactggtcagaatgaag; primer B: aatggaaaatacagctcccc), sY147 (primer A: ttt-ctcgtttgatgatcctag; primer B: ttaatatgagaatgagaacagatgt), sY149 (primer A: tgtcacactgccctaatcct; primer B: tggtcatgacaaaagacgaa) and Y6HP52 (primer A: aggaactggcaggattagcc; primer B: atgtcagggtttcct-ttgcc). The AZFa region is between sY81 and sY95. The sY117 and sY127 are within the AZFb region. AZFc contains sY153, Y6HP52, sY147 (DAZ), sY149 (DAZ) and sY277 (DAZ). The sY159 is distal to AZFc. In each PCR reaction, we used genomic DNA from normal fertile male as a positive control and DNA from normal female as a negative control. If there was any absence of PCR product in specific STS regions, more than two individual single-primer amplification reactions focused on the specific STS region were used to confirm the specificity of microdeletion of multiplex PCR. 2.6 Statistical analysis The Chi-square test and Fisher Exact P test was used to compare the results between groups. P<0.05 was considered significant. 3 Results 3.1 Y chromosome assay In the 334 patients, the occurrence of genetic defects was 22.5 %, including 53 (15.9 %) with chromosome disorder and 30 (9.0 %) with gene deletion on the Y chromosome. There were 8 cases (6 azoospermia and 2 severe oligoasthenospermia) with both chromosome disorder and gene deletion on the Y chromosome (Table 1). Patients with azoospermia had a higher incidence of chromosome disorder (20.6 %) than patients with severe oligoasthenospermia, however, in this study, patients with severe oligoasthenospermia had a higher incidence of Y gene deletion (10.3 %) than those with azoospermia (8.3 %) (Table 1). In our routine screening for Y chromosome microdeletion, we found there are thirty cases (18 azoospermic and 12 severe oligoastheno-spermic) out of 334 infertile patients had deletion of the variable portions of the Yq arm. In this study, the deletion area on Y chromosome was classified into 2 groups in correspondence with the 2 AZF regions and the severity of spermatogenic deficit (Figure 1). Group 1 (19 cases) had one case with microdeletion distal to the AZFc region on the long arm of Y chromosome and the other 18 cases had their Y chromosome gene in AZFc region (between sY153 and sY277). Group 2 (11 cases) include 2 cases with deletions in AZFb, and the other 8 had 6 kinds of deletions with variable length of region located from AZFc to AZFb. Table 1. Genetic defects in 334 patients with azoospermia or severe oligoasthenozoospermia
* Six patients had both chromosome
disorder and Y gene deletion. Table 2. Microdeletions on Y chromosome.
Figure 1. Distribution of the 2 groups, different types of Y chromosome microdeletion with correlation to the sperm concentration and concomittent chromosome anomaly in 30 patients with azoospermia and severe oligoasthenospermic. 3.2 General chromosomal assay Concomitant general chromosomal examination was done in these 30 patients. In this study, 8 of the 30 patient (26.7 %) with gene deletion of Y chromosome were found to have additional chromosome anomalies (Table 3). It was higher than that (17.5 %) of the accumulated 302 patients without microdeletion of Y chromosome gene. The comparative analysis also showed the percentage of chromosomal anomaly in patients with Y chromosomal gene microdeletions was higher than that in non-deletion patients either in the azoospermia group (33.3 % to 20.6 %, respectively) or oligoasthenospermia group (16.7 % to 6.9 %, respectively). Chromosomal anomaly is generally occurred more frequently in the azoospermia patients with microdeletions of Y chromosome gene (6 in 18). Patient with microdeletion in AZFb area or both AZFc and AZFb areas had a significantly higher percentage (6/11, 54.5 %) of additional chromosome anomalies than those with microdeletion within AZFc area (2/19, 10.53 %) (Table 3). Table 3. Occurrence of other chromosome anomalies in 30 infertile patients with Y chromosome microdeletion. Patient with microdeletion in Group 2 had a higher (P<0.05) percentage (6/11, 54.5%) of other chromosome anomalies than that of Group 1 (2/19, 10.53); *possible normal variants, **sperm count less than l?06/mL and/or motile sperm less than 10%.
3.3 Clinical relevance If we evaluated the testicular function, sperm appeared in the semen must be the strongest evidence for definite spermatogenesis. Thus, the percentage of oligoasthenospermia patients could represent the gerenal distribution of the functional testis with spermatogenesis in the patients with Y chromosome gene deletion. It is a decline of the percentage of sperm appear in semen (from 52.6 % to 27.3 %) from the group that the gene deletion region involved only in AZFc or more distal (Group 1) to the gene deletion region involved AZFb and AZFc (2I) (Table 4). The testicular size reduction and serum FSH elevation were more marked in groups with gene deletion involved both AZFb and AZFc. The average percentage of the normal testicular size and normal serum FSH is 78.9 % and 52.6 %, respectively; in patients with gene deletions within AZFc or more distal regions (Group 1), however, they were 45.5 % and 36.4 %, respectively, when the deletions involved AZFb or both AZFb and AZFc. Table 4. Difference of clinical manifestations between 2 groups of Y Chromosome gene microdeletion.
Eleven patients (10 azoospermia and 1 oligoastheno-spermia) received testicular biopsy for pathological exami-nation. An oligoasthenospermia patient with microdeletion involved both AZFb and AZFc area of Y chromosome had a normal spermatogenesis in the testicular biopsy during the ICSI procedure. However, there were 3 patients with microdeletion involved AZFc area had more prominent spermatogenic impairment (1 with maturation arrest, 2 with Sertoli cell only) (Table 5). The result is, not relevant to other clinical evidence of poorer spermatogenic function of deletion from AZFc to AZFb was found in this study. Table 5. Pathological evidence of spermatogenesis in azoospermia patients with Y chromosome microdeletion
4 Discussion Microdeletions in the azoospermia factor (AZF) region of the Y chromosome have first been described in azoospermic patients by Tiepolo et al [12]. It was then found that patients with severe oligozospermia patients also might result from deletion of AZF gene on Y chromosome [13, 14]. Since an analytic study of 76 infertile men with microdeletion of DNA loci in Yq11, it was proposed to have three spermatogenic loci, designated as AZFa, AZFb and AZFc, with a correlative severity of the spermatogenesis impairment [4]. However, the recent reports showed this proposed correlation and the clinical relevance to be more complicated and unpredictable [2,5]. The frequency of Y chromosome microdeletions in our 218 azoospermic patients is 8.3 % whereas the frequency in 116 oligoasthenospermic patients is 10.3 % (Table 1). It is not compatible to the result of an accumulated study for the overall frequency of Y chromosome microdeletion with 1473 cases of infertile men[11]. It showed the frequency of Y chromosome microdeletion is much high (12.2 %) in azoospermic men (n=581) than in oligoasthenospermic patients (3.4 %) (n=892). Higher frequency of Y chromosome micro-deletion in our oligozoospermic patients may be due to less or rather selective oligozoasthenospermic patients recruited in our series. Another possibility is the majority of our 30 cases have the deleted regions within or distal to AZFc (n=19), with higher percentage of sperm appeared in the semen (47.4 %, 9 in 19) than that of the deleted regions involved AZFb or both AZFb and AZFc (27.3 %, 3 in 11) (Table 4). It is a consensus that the deletions of the complete AZFc region (SY153-SY158) are the most common type and are frequently associated with variable spermatogenesis impairment [2, 11]. and possibly to produce sons by intracytoplasmic sperm injection (ICSI) [15] and transmission of AZFc deletion from the father to the male offspring [16]. In comparison to the general population of the infertile male, the prevalence of chromosome anomaly in the patients with microdeletion of the gene in Y chromosome is found to be higher in this study (Tables 1 and 3). Both in the azoospermia group and severe oligoasthenospermia group, the chromosome anomaly other than microdeletion of the gene in Y chromosome seems to be so frequent that there may have a multiple chromosome disorder existed in these patients. Some of the numerical chromosome disorder happened in the azoospermia patients, however, most were structural disorder appeared both in the azoospermia and severe oligozoospermia patients (Table 3). Various translocations, inversions are usually believed to be a consequence of breakage that occurs during meiosis and thought to be responsible for defective spermatogenesis [17]. Clinically, the majority of the patients do not have any associated problems except infertility. It was reported that patients with severe oligoasthenospermia had a statistically more significant rate of embryo development arrest than those where a male factor is not involved [18]. High fertilization rate was also found in conventional in vitro fertilization utilizing spermatozoa from an oligozoospermic subject with microdeletion of the Y chromosome [15]. Counseling before the procedure of intracytoplasmic sperm injection, as well as pre-implantation genetic diagnosis for the patients with chromosome anomaly became our routine procedure in recent years [19]. The type of deletion area and deletion length has been proposed as a potential prognostic factor for sperm retrieval in the treatment of male infertility with the procedure of testicular sperm extraction [20, 21]. The possibility of sperm appear in the clinical examination of semen analysis (it means severe oligoasthenospermia) is only 27.3 % when deletion involves into the AZFb area. In comparison, when the gene of AZFb area is spared for the microdeletion, 52.6 % of these cases could be found to have sperm in semen analysis (Table 4). Other clinical evidence of the spermatogenesis, most importantly, normal testicular size and normal serum FSH level, can also be proved in this study to support the prognostic value in correlation to the different deletion areas. The percentage of normal size testis and normal serum FSH level declines when the deletion area located into the AZFb area. Only 45.5 % of the patients with deletion involves AZFb area had normal size testis and 36.4 % of them had normal serum FSH level that was compatible to the low incidence to find sperm in the semen The pathological finding of the testicular biopsy in this study is poorly correlated with the different deletion areas of the Y chromosome. Sertoli cell only was found in the testicular tissue of the azoospermia patients with the microdeletion gene localized only within the AZFc regions [22]. There are also some cases of azoospermia with the microdeletion gene scattered or extended to AZFb area of the Y chromosome, however, the testicular biopsy revealed hypospermatogenesis with some spermatid present in the seminiferous tubule even clinically without any evidence of spermatogenesis [23]. The poor correlation between the pathological result and the clinical findings may be due to the small size of the samples. Patients with microdeletion of Y chromosome gene were not so frequent to receive testicular biopsy except for their decision to do sperm retrieval for the ICSI program, so the information of the testicular pathology is limited. Acknowledgments This study is supported by the grants from the National Science Council of Taiwan, China (NSC89-2314-B-038-080. References [1] Chiang
HS, Wei HJ, Chen YT. Genetic screening for patients with azoospermia and
severe oligo- asthenospermia. Int J Androl 2000; 23: 20-5. Correspondence
to: Han-Sun Chiang, M.D.,
College of Medicine, Fu-Jen Catholic University, Taipei, 510, Chung-Cheng
Rd., Hsin-Chuang, Taipei Hsien, 24205 China.
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||