|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Microdeletions in the Y chromosome of patients with idiopathic azoospermia Akiyuki Shimizu1, Tomohiko Ichikawa1, Noriyuki Suzuki1, Takako Yamazaki1, Takashi Imamoto1, Satoko Kojima1, Yukio Naya1, Akira Komiya1, Hiroyoshi Suzuki1, Koichi Nagao2, Kazukiyo Miura2, Haruo Ito1 1Department of Urology,
Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan Asian J Androl 2002 Jun; 4: 111-115 Keywords:
|
|
STS |
Left
primer |
Right
primer |
Product
Size (bp) |
| sY274 |
TTAAGGGGACAGTATTTCAACTTC |
CCACATTTAAACTGAGTACAGTCC |
350 |
| sY238 |
AACAAGTGAGTTCCACAGGG |
GCAAAGCAGCATTCAAAACA |
350 |
| RBM |
ATGCACTTCAGAGATCGG |
CTTTGAAAACAATTCCTTTTCC |
800 |
| sY78 |
TCCTTTTCCACAATAGACGTCA |
GGAAGTATCTTCCTTAAAAGCTATG |
170 |
| sY142 |
AGCTTCTATTCGAGGGCTTC |
CTCCTGCAATCCCTGACAT |
196 |
| sY143 |
G
CAGGATGAGAAGCAGGTAG |
CCGTGTGCTGGAGACTAATC |
311 |
| sY153 |
GCATCCTCAATTTTATGTCCA |
CAACCCAAAAGCACTGAGTA |
139 |
| sY152 |
AAGACAGTCTGCCATGTTTCA |
ACAGGAGGGTACTTAGCAGT |
125 |
| sY147 |
TTTCTCGTTTGATGATCCTAG |
TTAATATGAGAATGAGAACAGATGT |
100 |
| sY146 |
ACAAAAATGTGGCTCAGGGA |
AAATAGTGTGCCCACCCAAA |
173 |
| sY254 |
GGGTGTTACCAGAAGGCAAA |
GAACCGTATCTACCAAAGAGC |
107 |
| sY255 |
GTTACAGGATTCGGCGTGAT |
CTCGTCATGTGCAGCCAC |
126 |
| sY277 |
GGGTTTTGCCTGCATACGTAATTA |
CCTAAAAGCAATTCTAAACCTCCAG |
275 |
| sY283 |
CAGTGATACACTCGGACTTGTGTA |
GTTATTTGAAAAGCTACACGGG |
375 |
| sY158 |
CTCAGAAGTCCTCCTAATAGTTCC |
ACAGTGGTTTGTAGCGGGTA |
231 |
| sY160 |
TACGGGTCTCGAATGGAATA |
TCATTGCATTCCTTTCCATT |
236 |
2.3 Deletion analysis by polymerease chain react
Genomic DNA was extracted from peripheral blood granulocytes using the QIAamp blood maxi kit (QIAGEN, California, USA). PCR analysis was performed with 50 ng of genomic DNA in a final volume of 50 mL, comprising of the reaction buffer (0.5 % dimethylsulfoxide), 0.2 mmol/L diethylnitrophenyl thiophosphate mix, 10 pmol of each primer, and Taq DNA polymerase. Thermocy-cling consisted of an initial denaturation of 5 minutes at 94, followed by 35 cycles of 30 seconds at 94 (melting), 30 seconds at 55 (annealing), and 1 minute at 72 (extension), and finally 5 minutes at 72. PCR products were separated by 1.5 % agarose gel electro-phoresis, stained with ethidium bromide, and visualized using ultraviolet transillumination.
3 Results
3.1 Clinical findings
Of the 58 consecutive azoospermic patients, 29 showed idiopathic azoospermia and were enrolled in this study (Table 2). These 29 patients demonstrated a karyotype of 46,XY without any apparent cytogenetic abnormalities by conventional G-banding analysis. Clinical findings for these patients are summarized in Table 3.
Table 2. Characteristics of 58 patients with azoospermia
|
Cause
of azoospermia |
No.
of Patients |
| Idiopathic |
29 |
| Varicocele |
10 |
| Endocrinopathya |
8 |
| Obstruction |
6 |
| Chromosomal
abnormalityb |
4 |
| Infection |
1 |
aAll patients with endocrinopathy
had hypogonadotropic hypogonadism.
bTwo cases: 45,X/ 46,XdicY(q11.2), one case: Klinefelter,s
syndrome, one case: XX male.
Table 3. Summary of finding in 29 idiopathic azoospermic patients. Values are meanSD.
|
Microdeletions |
Total |
Age |
Average
testis |
LH |
FSH |
PRL |
T |
|
Positive |
3 |
35.38.4 |
16.36.8 |
4.23.0 |
25.414.7 |
14.511.6 |
2.580.44 |
|
Negative |
26 |
32.05.3 |
15.76.0 |
6.13.9 |
24.515.5 |
11.67.6 |
4.312.2 |
3.2 Immunohistochemical staining and TGF-b1 index
Testicular biopsy was performed in 16 of the 29 azoospermic patients. Histologic diagnosis identified 3 cases of Sertoli-cell-only syndrome, 4 maturation arrest, 8 hypospermatogenesis and 1 normal spermatogenesis.
3.3 Microdeletions in the Y chromosome
Screening for microdeletions in the Y chromosome was performed in the 29 patients. Interstitial deletions of Yq were found in 3 (10.3 %, Figures 1 and 2). All deletions overlapped with STSs ( sY254, sY255, sY283) for the DAZ gene (Figure 1). There were no deletions in the AZFb subregion (sY142, sY143). Table 4 summarizes the hormonal and histologic characteristics of the 3 patients with idiopathic azoospermia who had Yq micro-deletions.
Figure
1. An example of PCR analysis for sY255 in patients with azoospermia.
Lane a, #3 patient indicated in Table 4; Lanes b and c, patients with
idiopathic azoospermia without deletion. bp = base pairs.
Figure 2. Summary
of STSs and PCR data of the three patients with Yq microdeletions. Deletion
intervals and Y-chromosome STSs used are listed above. The solid black
boxes indicate presence of the STSs. Blank spaces indicate absence of
the STS.
Table 4. Phenotypic features of azoospermic men with Yq microdeletions. aSCO, Sertoli cell only. bN.D., not determined.
|
Patient |
Age |
Average
testis |
LH |
FSH |
PRL |
T |
Biopsy |
|
1 |
45 |
11 |
6.3 |
35.8 |
6.3 |
2.9 |
SCOa |
|
2 |
30 |
14 |
7.8 |
27.9
|
12.4 |
6.5 |
N.D.b |
|
3 |
31 |
24 |
2.1 |
15.0 |
22.7 |
2.3 |
N.D. |
4 Discussion
About a quarter of a century ago, Tiepolo and Zuffardi [1] reported six azoospermic men with gross deletion of the Y chromosome and postulated the existence of a factor, located on the Y chromosome, that is necessary for normal spermatogenesis. Later, this factor was named azoospermia factor (AZF). More recently, small interstitial deletions (microdeletions) have been detected using molecular techniques. Two candidate genes for AZF have been suggested: RBM (RNA binding motif) [2] and DAZ [3]. Both genes are expressed in the testis and encode a presumed RNA-binding protein, the precise function of which remains to be determined. RBM seems to be a gene family and multiple copies are distributed along the Y chromosome. The DAZ gene is equivalent to AZFc, as indicated by Vogt et al[4], who suggested the presence of three spermatogenesis loci in Yq11 and designated them AZFa (proximal), AZFb (central) and AZFc (distal); They hypothesized a correlation between specific spermatogenic defects and a well-defined Yq11 microdeletion pattern, suggesting that deletions occurring in AZFa result in Sertoli-cell-only syndrome and deletions in AZFb result in spermatogenic arrest. However, in other similar studies these associations were not evident. Initially, DAZ was thought to be a single copy, however, it is now known as the DAZ gene family on Yq11 and has an autosomal copy on the short arm of chromosome 3 ( DAZL or DAZH) [9].
In the literature, the occurrence of microdeletions varies between 1 % and 55 % [10-14]. Most microdele-tions have been found in patients with idiopathic azoospermia or severe oligozoospermia. Among our cases, mi-crodeletions were detected in 3 of 29 patients with idiopathic azoospermia (10.3 %). This frequency is within the range of previous studies.
Apart from sporadic cases of natural transmission of similar or identical Y chromosome microdeletions [15], the majority of deletions are believed to be de novo [16,17], i.e. somatic events arising randomly in some germ cells of fertile men who thereby produce an infertile son with a Y chromosomal defect in his genome. Until recently, such an individual would normally be infertile and further transmission of the genetic defect would not occur. However, ICSI now offers an effective therapeutic option for these men, and Yq microdeletions can be transmitted to male offspring [16-19]. Mulhall et al.[6] demonstrated that men with nonobstructive azoospermia with only AZFc deletions may harbor spermatozoa, allowing effective fertilization, normal embryo development and term pregnancy via TESE and ICSI. Kent-First et al. [20] analyzed the AZF genes in DNA from the blood of 32 infertile men and their sons conceived through ICSI. They found microdeletions in one infertile father and three ICSI infants. The infertile father and his son had identical microdeletions in the AZF genes. Therefore, DNA screening for the AZF genes as well as conventional cytogenetic studies in infertile males have been suggested to be necessary before ICSI [21-24]. Although the pre-sent three cases with Yq microdeletions have not undergone TESE and ICSI, these couples should receive careful genetic counseling to allow them to make a well-informed choice about reproduction and family planning.
References
[1] Tiepolo L, Zuffardi O.
Localization of factors controlling spermatogenesis in the nonfluorescent
portion of the human Y chromosome long arm. Hum Genet 1976;34: 119-24.
[2] Ma K, Inglis JD, Sharkey A, Bickmore WA, Hill RE, Prosser EJ, et
al. A Y chromosome gene family with RNA-binding protein homology:
candidates for the azoospermia factor AZF controlling human spermatogenesis.
Cell 1993; 75: 1287-95.
[3] Reijo R, Lee T-Y, Salo P, Alagappan
R, Brown LG, Rosenberg M, et al. Diverse spermatogenic defects
in humans caused by Y chromosome deletions encompassing a novel RNA-binding
protein gene. Nat Genet 1995; 10:383-93.
[4] Vogt PH, Edelmann A, Kirsh S, Henegariu
O, Hirshmann P, Kiesewetter F, et al. Human Y-chromosome azoospermia
factors (AZF) mapped to different subregions in Yq11. Hum Mol Genet 1996;
5: 933-43.
[5] Reijo R, Alagappan PK, Patritio P, Page DC. Severe oligozoospermia
resulting from deletions of azoospermia factor gene on Y chromosome. Lancet
1996; 347: 1290-3.
[6] Mulhall JP, Reijo R, Alagappan R, Brown L, Page D, Carson R, et
al. Azoospermic men with deletion of the DAZ gene cluster are capable
of completing spermatogenesis: fertilization, normal embryonic development
and pregnancy occur when retrieved testicular spermatozoa are used for
intracytoplasmic sperm injection. Hum Reprod 1997; 12: 503-8.
[7] World Health Organization. Laboratory manual for the examination of
human semen and semen-cervical mucus interaction. 4th edn. New York: Cambridge
university Press, 1999.
[8] Takahara M, Ichikawa T, Shiseki Y, Nakamura T Shimazaki J. Relationship
between de grade of varicocele and the response to varicocelectomy. Int
J Urol 1996; 3: 282-5.
[9] Sexena R, Brown LG, Hawkins T, Alagappan RK, Skaletsky H, Reeve MP,
et al. The DAZ gene cluster on the human Y chromosome arose from
an autosomal gene that was transposed, repeatedly amplified and pruned.
Nature Genet. 1996; 14: 292-9.
[10] Simoni M, Kamischke A, Nieschlag E. Current status of the molecular
diagnosis of Y-chromosomal microdeletions in the work-up of male infertility.
Hum Reprod 1998; 13: 1764-8.
[11] Foresta C, Ferlin A, Garolla A, Moro E, Pistorello M, Barbaux S,
et al. High frequency of well-defined Y-chromosome deletions in
idiopathic Sertoli cell-only syndrome. Hum Reprod 1998; 13: 302-7.
[12] Suzuki N, Ichikawa T, Ohta S, Hosoki S, Komiya A, Suzuki H, et
al. The Azoospermia Factor (AZF) in Azoospermia Patients. Jpn J Fertil
Steril 1999; 44: 179-186.
[13] Fujisawa M, Shirakawa T, Kanzaki M, Okada H, Arakawa S, Kamidono
S. Y-chromosome microdeletion and phenotype in cytogenetically normal
men with idiopathic azoospermia. Fertil Steril 2001; 76: 491-5.
[14] Peterlin B, Kunej J, Shinkovec J, Gligorievska N, Zorn B. Screening
for Y chromosome microdeletions in 226 Slovenian subfertile men. Hum Reprod
2002; 17: 17-24.
[15] Chang PL, Sauer MV, Brown S. Y chromosome microdeletion in a father
and his four infertile sons. Hum Reprod 1999; 14: 2689-94.
[16] Kremer JAM, Tuerlings JHAM, Meuleman EJH, Schoute F, Mariman E, Smeets
DFCM, et al. Microdeletions of the Y chromosome and intracytoplasmic
sperm injection: from gene to clinic. Hum Reprod 1997; 12: 687-91.
[17] Silber SJ, Alagappan R, Brown LG,Page DC. Y chromosome deletions
in azoospermic and oligozoospermic men undergoing intracytoplasmic sperm
injection after testicular sperm extraction. Hum Reprod 1998; 13: 3332-7.
[18] Page DC, Silber S, Brown LG. Men with infertility caused by AZFc
deletion can produce sons by intracytoplasmic sperm injection, but are
likely to transmit the deletion and infertility. Hum Reprod 1999; 14:
1722-6.
[19] Kamischke A, Gromoll J, Simoni M, Behre HM, Nieschlag E. Transmission
of a Y chromosomal deletion involving the deleted in azoospermia (DAZ)
and chromodomain (CDY1) genes from father to son through intracytoplasmic
sperm injection. Hum Reprod 1999; 14: 2320-2.
[20] Kent-First MG, Kol S, Muallem A, Ofir R, Manor D, Blazer S, et
al. The incidence and possible relevance of Y-linked microdeletion
in babies born after intracytoplasmic sperm injection and their infertile
fathers. Mol Hum Reprod 1996; 2: 943-50.
[21] Krausz C, Bussani-Mastellone C, Granchi S, McElreavey K, Scarselli
G, Forti G. Screening for microdeletions of Y chromosome genes in patients
undergoing intracytoplasmic sperm injection. Hum Reprod 1999; 14: 1717-21.
[22] Nap AW, Van Golde RJT, Tuerlings JHAM, Sutter PD, Pieters MHEC, Giltay
JC, et al. Reproductive decisions of men with microdeletions of
the Y chromosome: the role of genetic coun-seling. Hum Reprod 1999; 14:
2166-9.
[23] Krausz C, Quintana-Murci L, McElreavey K. Prognostic value of Y deletion
analysis. What is the clinical prognostic value of Y chromosome microdeletion
analysis? Hum Reprod 2000; 15: 1431-4.
[24] Dohle GR, Halley DJJ, Van Hemel JO, van den Ouwel AMW, Pieters MHEC,
Weber RFA, et al. Genetic risk factors in infertile men with severe
oligozoospermia and azoospermia. Hum Reprod 2002; 17: 13-6.
Correspondence
to: Tomohiko Ichikawa,
M.D., Ph.D., Department of Urology (E5), Graduate School of Medicine,
Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba-shi, Chiba 260-8670, Japan.
Tel: +81-43-226-2134, Fax: +81-43-226-2136
E-mail: ichikawa@urology1.m.chiba-u.ac.jp
Received
2002-04-23 Accepted 2002-05-08
