This web only provides the extract of this article. If you want to read the figures and tables, please reference the PDF full text on Blackwell Synergy. Thank you.

- Original Article -

Expression of a novel beta adaptin subunit mRNA splice variant in human testes

Xin-Dong Zhang, Lan-Lan Yin, Ying Zheng, Li Lu, Zuo-Min Zhou, Jia-Hao Sha

Key Laboratory of Reproductive Medicine, Nanjing Medical University, Nanjing 210029, China

Abstract

Aim: To identify a novel isoform of adaptin 2 beta subunit (named Ap2β-NY) and to investigate its relationship with testicular development and spermatogenesis. Methods: Using a human testis cDNA microarray, a clone (Ap2β-NY), which was strongly expressed in adult testes but weakly expressed in embryo testes, was sequenced and analyzed. Using polymerase chain reaction (PCR), the tissue distribution and expression time pattern of Ap2β-NY were determined. Results: Ap2β-NY was identified and has been deposited in the GenBank (AY341427). The expression level of Ap2β-NY in the adult testis was about 3-fold higher than that in the embryo testis. PCR analysis using multi-tissue cDNA indicated that Ap2β-NY was highly expressed in the testis, spleen, thymus, prostate, ovary, blood leukocyte and brain, but not in the heart, placenta, lung, liver, skeletal muscle, kidney and pancreas. In addition, Ap2β-NY was variably expressed in the testes of patients with spermatogenesis-disturbance and spermatogenesis-arrest but not expressed in those of Sertoli-cell-only syndrome, which implied that, in the testis, Ap2β-NY was restrictively expressed in germ cells. Conclusion: Ap2β-NY is an isoform of Ap2β and may be involved in regulating the process of spermatogenesis and testis development. (Asian J Androl 2005 Jun; 7: 179-188)

Keywords: alternative splicing; adaptin beta subunit; spermatogenesis

Correspondence to: Dr Jia-Hao Sha, Key Laboratory of Reproductive Medicine, Nanjing Medical University, Nanjing 210029, China.

Tel/Fax: +86-25-8686-2908
E-mail: shajh@njmu.edu.cn
Received 2004-08-11 Accepted 2004-12-09
DOI: 10.1111/j.1745-7262.2005.00025.x

Adaptin 2 beta subunit (Ap2β-NY) is a part of the adaptin protein 2 (AP2) coat assembly protein complex which links clathrin to receptors in the coated vesicles [1]. Previously, the AP2 adaptor was reported as a complex composed of two large ~110 kDa subunits (and β2), one medium ~50 kDa subunit (μ2) and one small
~17 kDa subunit (s2) [2, 3]. Each large subunit can be divided into a 60-70 kDa trunk domain separated from a 25-30 kDa appendage domain (sometimes referred to as an "ear" domain) by a ~100-residue, protease-sensitive linker [4]. AP2 links the endocytic cargo (ligand and receptor) to the clathrin coat and the internalization occurs through forming clathrin-coated vesicles (CCVS). The a subunit interacts with CCV formation regulatory protein or accessory proteins such as AP180, auxilin, amphiphysin, eps15 and epsin via its appendage domain [5, 6]. The β2 subunit binds to clathrin via the canonical clathrin box motif (LFxFD/E, where F is a bulky hydrophobic amino acid and x represents any amino acid) [7, 8] in its linker or hinge region [9]. In addition, AP2 adaptor binds to the short linear internalization motifs on cargo molecules, YxxF via the m2 subunit [10, 11] and D/ExxxLL probably via the β2 trunk domain [12]. It was confirmed by Yao et al. that AP2/transforming growth factor beta (TGF-β) receptor binding was mediated by a direct interaction between the β2 subunit N-terminal trunk domain and the cytoplasmic tails of the receptors [13]. AP2 adaptor is one of the intriguing proteins playing central roles in clathrin-mediated endocytosis. Clathrin-mediated endocytosis is involved in many cellular processes including the internalization and subsequent down-regulation of activated growth factor receptors, regulating the number and type of small molecule receptors, channels and transporters in the plasma membrane, recycling of synaptic vesicles and the maintenance of membrane identity.

On the basis of the adult testis cDNA microarrays prepared by this laboratory, we compared the genes expressed in the adult testis and embryo testis at a high throughput [14]. Here we report a gene coding a novel isoform of adaptin 2β subunit (Ap2β), named Ap2β-NY. The structure analysis results and distribution pattern of Ap2β-NY in the testis indicated its presumable functions in the regulation of testicular development and spermatogenesis by affecting protein transportation through CCV conformation changing.

2 Materials and methods

2.1 Construction of human cDNA microarrays

A total of 9216 positive phage clones were picked out randomly from Human Testis Insert l phage cDNA library (clontech, Hl5503U) and amplified by po;ymerase chain reaction (PCR). Then the PCR products were spotted on the nylon membrane to make human testis cDNA microarray. Protocol for cDNA microarray preparation has been described in detail recently [14].

2.2 Array scanning and analyzing clones of interest

After being hybridized with the 33P-labeled embryo testis and adult testis cDNA probes respectively, the arrays were scanned and read out using the array gauge software (Fuji Photo Film, Tokyo, Japan). After subtraction of background, clones with intensities >10 were considered positive signals. Then interested clones were sequenced using the ABI 377 automatic sequencing machine and analyzed (see also in Sha et al. and Wang et al. [14, 15] ).

2.3 Multiple tissue distribution of Ap2β-NY

To determine the tissue distribution of Ap2β-NY, specific primers overlapping an intron were designed to amplify cDNAs from sixteen kinds of human tissues (heart, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas, spleen, thymus, prostate, testis, ovary, small intestine, colon and blood leukocytes), purchased from Clontech (K1420-1 and K1421-1). The primers specific to Ap2β-NY were as following: P1 5' GACCATCTATCTAAGGAGTTG 3 ' and P2 5' TTGTCTACCCGGATGCAC 3'. The PCR products (255 bp) of sixteen tissues were resolved by electrophoresis on 1 % agarose gel and transferred to Hybond-N+ nylon membrane (Amersham Pharmacia Biotech, Little Chalfont, Buckinghamshire, UK).

The Ap2β-NY cDNA probe was generated with the same primers used for the PCR. The template was Ap2β-NY clone plasmid, and digoxigenin (Dig)-labeled dNTPs were used (Dig DNA Labeling Mix; Roche Diagnostics, Indianapolis, USA). The reaction protocol was as following: 35 cycles of 94 ℃ for 30 sec, 44 ℃ for 30 sec and 72 ℃ for 60 sec. Hybridization was performed according to the Instruction Manual of Roche (DIG High Prime DNA Labeling and Detection Starter Kit II, Cat.No.1585614). After hybridization, the membrane was incubated with alkaline phosphatase (Ap)-conjugated anti-DIG antibodies and visualized with immunological detection through chemiluminescent substrate for alkaline phosphatase (CSPD; Roche). Human β-actin was used as the positive control and the primers used were: P3 5'CGGTTGGCCTTGGGGTTCAGGGGG 3' and P4 5' ATCGTGGGGGCGCCCCAGGCACCA 3'.

2.4 Expressional state in a different development stage and in patients of abnormal spermatogenesis

Human adult (37 years) and aged (73 years) testes were obtained from the Body Donor Center (Nanjing Medical University). Embryo testes were from accidentally aborted 6-month fetuses. Human ejaculates were obtained from healthy volunteers of proven fertility and of normal semen quality as assessed by WHO criteria (1999). Samples of patient testes were obtained via biopsy from 12 infertile men at the First Affiliated Hospital of Nanjing Medical University (Nanjing, China). The clinical diagnoses based on testicular biopsy were Sertoli-cell-only Syndrome (SCOS), spermatogenesis-arrest at different stages and spermatogenesis-disturbance, each [Internet]. S. Knudsen. Bioinformatics: 15, 356-361; [cited 22 February 2005]. Available from: http://www.cbs.dtu.dk/services/Promoter/).

3 Results

3.1 cDNA microarray hybridization

After hybridization and data analysis, genes differentially expressed in human adult and embryo testes were considered as testicular development and spermatogenesis-related. Among those, a novel alternative splicing form of Ap2β was identified. The hybridization intensity of Ap2β-NY in the adult testis and embryo testis was 140.22 and 38.73, respectively (Figure 1). Obviously, Ap2β-NY was expressed both in the adult and embryo testis, but the expression level in the adult testis was approximately 3-fold more than that in the embryo testis.

3.2 Sequence identification and analysis of the Ap2β-NY gene

The full nucleotide and putative amino acid sequences of Ap2β-NY are displayed in Figure 2. The 3457 bp Ap2β-NY cDNA contains a complete open reading frame (ORF) of 2642 bp with a methionine start codon at the position 396 and a TGA stop codon at the position 3038. The first start codon is preceded by an in-frame stop codon TAA at position 354, suggesting that ATG at position 396 is the start codon for the Ap2β-NY protein. Ap2β-NY encoded an 880-amino acids protein with predicted molecular weight of 98.12 kDa and isoelectric point, 5.01. In addition, two different promoters, located at -2300 and -1200 respectively, were found upstream in the sequence by use of Promoter 2.0 (Promoter 2.0 matogenic disturbance and spermatogenesis-arrest (Figure 7). It is well known that in SCOS, there is no germ cell but only Sertoli cells in the seminiferous tubules. Therefore, Ap2β-NY was not expressed in Sertoli cells and Leydig cells, but in spermatogenic cells.

Figure 2. Nucleic acid and deduced amino acid sequences of the cDNA for Ap2?NY. Underlining shows PCR primers for the determination of expression profile. Upstream primer is located in the specific region of Ap2?NY. Downstream primer is homologous with that of other genes of the Ap2βfamily. Initiation and stop codons are in italic type.

3.3 Homologous analysis of Ap2β-NY and Ap2β

A Basic local alignment search tool (BLAST) search in the human genome database localized the Ap2β-NY gene to 17q11.2-q12. BLAST-nr showed Ap2β-NY had a marked similarity to Ap2β (Figure 3). The former has a distinct 5-UTR and it is 57 amino acids shorter than the latter at the amino terminus. The Simple Modular Architecture Research Tool (SMART) (SMART [Internet]. Schultz J, Proc Natl Acad Sci, 95(11):5857-64, USA; [cited 22 February 2005] Available from: http://smart.embl-heidelberg.de/) results showed that both genes have an adaptin N, a low complexity and an adaptin C motif, but the adaptin N motif of Ap2β-NY is shorter than that of Ap2β. Protein composition analysis, using Gene Runner software (http://www.generunner.com), indicates that the deleted region is hydrophilic and is most likely exposed on the protein surface (Figure 4).

3.4 Tissue distribution of Ap2β-NY

The results of multiple tissue PCR and hybridization indicate that Ap2β-NY is expressed in several human tissues (Figure 5). It is highly expressed in the spleen, thymus, prostate, testis, ovary, blood leukocyte and brain, but not in the heart, placenta, lung, liver, skeletal muscle, kidney and pancreas.

3.5 Development-dependent expression

RT-PCR results show that Ap2β is strongly expressed in embryo, adult and aged testes (throughout the development stage of testis) while its expression level in spermatozoa is relatively lower (Figure 6). On the contrary, in spermatozoa and adult testes, Ap2β-NY has higher expression level, while it is poorly expressed in embryos and old testes. This expressional profile validates the microarray result at the same time. Together all these evidences support the concept that different splicing isoform of Ap2β-NY are predominant in various testis developmental stages and Ap2β-NY may be involved in testis development and spermatogenesis.

3.6 Ap2β-NY expression in infertile patient testes

The results of RT-PCR reveal that Ap2β-NY was not expressed in patients with Sertoli-cell-only syndrome (SCOS) and was variably expressed in those with sper
in four patients. All the samples were obtained after ethics approval and consent from all participants or their family. The total mRNA was isolated using the TRIzol Reagent (Gibcol, Grand Island, USA.) according to the manufacturer's instructions. Reverse transcription was performed using random primers (1 μL, 0.2 mg/mL; Sangon company, Shanghai, China) and 1 μL Moloney murine leukemin virus (MMLV) Reverse Transcriptase (10 U /μL, Promega, Madison, USA) in a 15 μL reaction mixture. Then RT-PCR was carried out to determine the expression of Ap2β-NY and Ap2β in subjects mentioned above. The primer-pairs used respectively were p1, p2 and p5, p6, which are also specific to Ap2β and its sequence is: P5 5' ATGTGGGAGGTGGATAGGTC 3' and p6 5' ATGGGTTGGCTCAGTCAGG 3'. The desired fragment for Ap2β is 283 bp. The resulting PCR products were identified by 1 % agarose gel electrophoresis and the expression level was analyzed.

4 Discussion

In the present study, a novel isoform of the Ap2β gene, named Ap2β-NY, was identified. Previously the Ap2β subunit was found in human fibroblast, rat lymphocyte, bovine lymphocyte, rat brain and bovine brain [4]. In the rat brain there was a 42 bp insert in the coding region, which was thought to be a result of alternative splicing of the Ap2β subunit [16]. This evidence reminds us that there may be a different splicing isoform of Ap2β in human tissue. Indeed, two promoters, located at -2300 and -1200 bp were found in the upstream of Ap2β using Promoter 2.0 (Position Score Likelihood was 1.101 and 1.112, respectively, highly likely prediction). In the present study, we further validated that Ap2β-NY was expressed in several human tissues. In testes, Ap2β-NY showed a developmental stage-dependent expression pattern. It was highly expressed in adult, spermatogenesis-active testes, but weakly in embryo and senile testes, suggesting its localization in spermatogenic cells and its relationship with spermatogenesis. Our further PCR analysis of infertile patients confirmed this. Ap2β-NY was not expressed in SCOS, but disordered in those of spermatogenic disturbances and spermatogenesis-arrest. Ap2β-NY was indicated to be a newly found regulator of spermatogenesis in male germ cells.

4.1 Hypothetic traffic model mediated by Ap2β-NY in testes

Bioinformatical analysis provides some information regarding the function of Ap2β-NY in spermatogenesis. SMART analysis showed that Ap2β-NY contained all the three motifs of Ap2β and is 57 amino acids shorter in the N-terminal region than Ap2β. The deleted region is hydrophilic and likely exposed on the surface of the protein, which, in general, was the position of protein interacting with others. Deletion of this region may have an influence on the capability of Ap2β binding with these cargo molecules, leading to an even greater default of binding. In embryo testes, Ap2β was predominant. It can transduce signals into cells by linking cargo proteins and clathrin. While in adult testes, Ap2β-NY was increas ingly expressed. It was shortened in trunk domain, which may result in decreasing affinity with cargo protein in adaptin. Consequently, the endocytosis of cargo proteins was curtailed. These cargo proteins, such as TGFβ receptor (TGFβR) and BubR1, are capable of regulating cell proliferation and differentiation, and thus affecting testicular development and spermatogenesis (Figure 8).

Spermatogenesis begins at puberty so there may be some growth inhibitory mechanism to prevent prepubertal spermatogenic cell proliferation. TGFβ is generally considered as a potent growth inhibitor and differentiation factor [17-19]. It has recently been revealed by Ingman that members of the transforming growth factor beta (TGFβ1, TGFβ2 and TGFβ3) play a key role in testicular development and spermatogenesis. It is responsible for the appropriate development and prevention of premature onset of spermatogenesis [20]. TGFβ reduced the number of gonocytes cultured in vitro by increasing apoptosis [21]. Yao et al. have proved that an N-terminal trunk domain of Ap2β was the only direct binding site of TGFβR. Shortened regions in the trunk domain may reduce the affinity of Ap2β with TGFβR. Fewer quantity of TGFβR could be transported into the cytoplasm. Accordingly, the inhibitory effect of TGFβ on gametogenesis was weakened, and at the same time spermatogenesis started. Although much attention was paid to the signal transduction of TGF, the mechanism is still unclear. Here, the existence of Ap2β splicing variant may, to some extent, shed light on how the signal of TGF is down-regulated not only in testes but also in other tissues containing Ap2β-NY. Of course more evidence is needed to support the hypothesis. In addition, the trunk domain of Ap2β was also the only binding site of mitotic checkpoint kinase BubR1 and Bub, both of which participate in the regulation of cell division [22]. It is suggested that Ap2β and its new isoform, Ap2β-NY, regulate the transportation of some other signal proteins in male gametogenesis. The disordered expression of Ap2β-NY in infertile patients also indicated its function in gametogenesis. Further investigation on the isoform of Ap2β should be valuable to elucidating the mechanism of spermatogenesis and infertile disease.

In summary, there is a novel splicing isoform of Ap2β, Ap2β-NY, in human testes. With regard to Ap2β and its cargos such as TGFβ and BubR1, the splicing isoform Ap2β-NY may, cooperating with Ap2β, regulate the transportation of signal proteins and thus play an important role in spermatogenesis and testicular
development.

Acknowledgment

This work was supported by grants from China National 973 (No. G1999055901), National Natural Science Fundation of China (No. 30425006), the Fundation of Science and Technology of Jiangsu Province, China (No. BG2003028) and the Foundation of National Department of Science and Technology, China (No. 2004CCA06800).

References

1 Druck T, Gu Y, Prabhala G, Cannizzaro LA, Park SH, Huebner K, Keen JH. Chromosome localization of human genes for clathrin adaptor polypeptides AP2 beta and AP50 and the clathrin-binding protein, VCP. Genomics 1995; 30: 94-7.

2 Traub LM. Clathrin-associated adaptor proteins putting it all together. Trends Cell Biol 1997; 7: 43-6.

3 Hirst J, Robinson MS. Clathrin and adaptors. Biochim Biophys Acta 1998; 1404: 173-93.

4 Kirchhausen T, Nathanson KL, Matsui W, Vaisberg A, Chow EP, Burne C, et al. Structural and functional division into two domains of the large (100- to 115-kDa) chains of the clathrin-associated protein complex AP2. Proc Natl Acad Sci USA 1989; 86: 2612-6.

5 Owen DJ, Vallis Y, Noble ME, Hunter JB, Dafforn TR, Evans PR, et al. A structural explanation for the binding of multiple ligands by the alpha-adaptin appendage domain. Cell 1999; 97: 805-15.

6 Traub LM, Downs MA, Westrich JL, Fremont DH. Crystal structure of the alpha appendage of AP-2 reveals a recruitment platform for clathrin-coat assembly. Proc Natl Acad Sci USA 1999; 96: 8907-12.

7 Dell'Angelica EC, Klumperman J, Stoorvogel W, Bonifacino JS. Association of the AP-3 adaptor complex with clathrin. Science 1998; 280: 431-4.

8 ter Haar E, Harrison SC, Kirchhausen T. Peptide-in-groove interactions link target proteins to the beta-propeller of clathrin. Proc Natl Acad Sci USA 2000; 97: 1096-100.

9 Shih W, Gallusser A, Kirchhausen T. A clathrin-binding site in the hinge of the beta 2 chain of mammalian AP2 complexes. J Biol Chem 1995; 270: 31083-90.

10 Ohno H, Stewart J, Fournier MC, Bosshart H, Rhee I, Miyatake S, et al. Interaction of tyrosine-based sorting signals with clathrin-associated proteins. Science 1995; 269: 1872- 5.

11 Owen DJ, Evans PR. A structural explanation for the recognition of tyrosine-based endocytic signals. Science 1998; 282: 1327-32.

12 Rapoport I, Chen YC, Cupers P, Shoelson SE, Kirchhausen T. Dileucine-based sorting signals bind to the beta Chain of AP-1 at a site distinct and regulated differently from the tyrosine-based motif-binding site. EMBO J 1998; 17: 2148-55.

13 Yao D, Ehrlich M, Henis YI, Leof EB. Transforming growth factor-beta receptors interact with AP2 by direct binding to beta2 subunit. Mol Biol Cell 2002; 13: 4001-12.

14 Sha JH, Zhou ZM, Li J, Yin L, Yang HM, Hu GX, et al. Identification of testis development and spermatogenesis-related genes in human and mouse testis using cDNA arrays. Mol Hum Reprod 2002; 8: 511-7.

15 Wang H, Zhou Z, Xu M, Li J, Xiao J, Xu ZY, et al. A spermatogenesis-related gene expression profile in human spermatozoa and its potential clinical applications. J Mol Med 2004; 82: 317-24.

16 Ponnambalam S, Robinson MS, Jackson AP, Peiperl L, Parham P. Conservation and diversity in families of coated vesicle adaptins. J Biol Chem 1990; 265: 4814-20.

17 Sporn MB, Roberts AB, Wakefield LM, Assoian RK. Transforming growth factor-beta: biological function and chemical structure. Science 1986; 233: 532-4.

18 Barnard JA, Lyons RM, Moses HL. The cell biology of transforming growth factor beta. Biochim Biophys Acta 1990; 1032: 79-87.

19 Moses HL, Yang EY, Pientpol JA. TGF-beta stimulation and inhibition of cell proliferation. New mechanistic insights. Cell 1990; 63: 245-7.

20 Ingman WV, Robertson SA. Defining the actions of transforming growth factor beta in reproduction. Bioessays 2002; 24: 904-14.

21 Olaso R, Pairault C, Boulogne B, Durand P, Habert R. Transforming growth factor beta1 and beta2 reduce the number of gonocytes by increasing optosis. Endocrinology 1998; 139: 733-40.

22 Cayrol C, Cougoule C, Wright M. The beta2-adaptin clathrin adaptor interacts with the mitotic checkpoint kinase BubR1. Biochem Biophys Res Commun 2002; 298: 720-30.

23 Alberts B, Johnson A, Lewis J, Raff M, Roberts K, Walter P. Molecular Biology of the Cell. Hamden: Garland Science; 2002.