This web only provides the extract of this article. If you want to read the figures and tables, please reference the PDF full text on Blackwell Synergy. Thank you.

- Original Article -

Expression of a novel dipeptidyl peptidase 8 (DPP8) transcript variant, DPP8-v3, in human testis

Hui Zhu, Zuo-Min Zhou, Li Lu, Min Xu, Hui Wang, Jian-Min Li, Jia-Hao Sha

Key Laboratory of Reproductive Medicine, Department of Histology and Embryology, Nanjing Medical University, Nanjing 210029, China

Abstract

Aim: To investigate the role of a novel dipeptidyl peptidase 8 transcript variant (DPP8-v3) gene in testis development and/or spermatogenesis. Methods: A human testis cDNA microarray was hybridized with mRNA of human adult and fetal testes. Differentially expressed clones were sequenced and characterized and their expression was analyzed by real-time reverse transcription polymerase chain reaction (RT-PCR) and Southern-blot analysis. Results: A new transcript variant of the human dipeptidyl peptidase (DPP8), exhibiting a 5-fold higher expression level in human adult than that in fetal testes, was cloned and was named DPP8 variant 3 (DPP8-v3). The full-length sequence of DPP8-v3 was 3,030 bp, encoding a protein of 898 amino acids. Conclusion: DPP8-v3 is a novel human DPP8 transcript variant highly expressed in the adult testis. Similar to DPPIV, DPP8-v3 may play a key role in the immunoregulation of testes and accordingly may influence spermatogenesis and male fertility. (Asian J Androl 2005 Sep; 7: 245-255)

Keywords: DPP8; dipeptidyl peptidase IV (DPPIV); DPP8-v3; immunoregulation; spermatogenesis; testis

Correspondence to: Dr Jia-Hao Sha, Key Laboratory of Reproductive Medicine, Nanjing Medical University, Nanjing 210029, China.

Tel/Fax: +86-25-8686-2908
E-mail: shajh@njmu.edu.cn
Received 2004-09-29 Accepted 2005-03-16
DOI: 10.1111/j.1745-7262.2005.00054.x

1 Introduction

Testis development and/or spermatogenesis is a highly ordered process that is strictly regulated by various factors therein the orderly expression of genes is the intrinsic factor which may directly influence the process of spermatogenesis. In addition, androgen is the major player in the extrinsic regulation of germ cell development [1, 2]. Over the past decade it has been accepted that, directly or indirectly, immunology intrudes into nearly every aspect of mammalian reproduction [3]. It has been confirmed that testis development/spermatogenesis requires the immune balance in the local environment of testis. On one hand, there is a perfect immune resistant system to protect the environment of spermatogenesis by diversiform immunocytes, such as macrophages and T-cells, in the testis. There is also a complicated network of cytokine in the testis. On the other hand, similar to other important organs, such as the brain and eye, the testis is an immune privilege organ - the immunoreaction against antigen is on the low level and inflammation is weak, which can avoid severe phlogistic harm on tissue structure. Especially, the mild immunoreaction prevents the formation of antibodies to spermatozoa in adult testes [4]. Therefore, there must be a complicated immune network in the testis to maintain its structure and function.

Dipeptidyl peptidase 8 (DPP8), which has been proven to be a member of the prolyl oligopeptidase S9B family, is probably a new candidate participating in the regulation of immune balance in testis. DPP8 was first cloned by Abbott et al. [5], who described it as a human postproline dipeptidyl aminopeptidase homologous to the dipeptidyl peptidase IV (DPPIV). A large number of studies have been done on the structure, biologic characteristics and potential functions of DPPIV, which have shown that it can participate in different biologic processes, such as chemokine biology, type-II diabetes and tumor biology [6, 7]. The critical role of DPPIV in immunoregulation has attracted researchers' attention especially. Previous studies all revealed that DPPIV was an important participant in immune regulation, especially in T-lymphocyte activation [5, 8]. Abbott et al. [5] have described the similarities between DPP8 and DPPIV in tissue expression pattern and substrates, suggesting that DPP8 may also have a potential role in T-cell activation and immune function. Three transcripts of the DPP8 gene, which can be spliced by different mechanisms, have been identified. Northern-blot analysis has shown that although differentially expressed in different human tissues, it is only in the testis that the three transcripts are all detected, which implicates that DPP8 plays a key role in the immune regulation of testes [5].

In a past study, we constructed cDNA microarrays from the human testis large insert cDNA library, containing 9216 genes, together with several housekeeping genes. On the basis of the cDNA microarray, we compared the expression of genes in the fetal and adult human testis at a high throughput [9]. A highly expressed novel human DPP8 transcript variant, DPP8-v3, was found in adult testes. In this study, the characteristics and tissue distribution of this novel DPP8 transcript variant, its expression in different developmental stages of testes and its possible correlation with testis development/spermatogenesis are discussed.

2 Materials and methods

2.1 Samples

Informed consent was received from either the participants or their kin and the approval to conduct this research was granted by the ethics committee of Nanjing Medical University before sample collection. Human testes from adult males (37-43 years old) were obtained from the Body Donor Center (Nanjing Medical University, Nanjing, China) and fetal testes from accidentally aborted 6-month-old fetuses (Clinical Reproductive Center, Nanjing Medical University, Nanjing, China).

2.2 Preparation of human testis cDNA microarray

The testis cDNA microarray was constructed as previously described [9]. Briefly, this microarray contained 9216 cDNA clones derived from a human testis 5'-STRETCH PLUS cDNA library (Clontech, Palo Alto, CA, USA; source of insert cDNA came from 25 Caucasians, aged from 20 to 65 years). The inserts were amplified by PCR using 5'-CCATTGTGTTGGTACCCGGG AATTCG-3' as a forward primer and 5'-ATAAGCTTGC TCGAGTCTAGAGTCGAC-3' as a reverse primer. In each 100 mL PCR reaction buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, pH8.4), 2 mmol/L MgCl₂, 0.15 mmol/L dNTPs, 4U Taq polymerase, 25 pmol of each primer and 20 ng of plasmid DNA were added. The reaction started with an initial denaturation at 95 °C for 4 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s and extension at 72 °C for 3 min and additional extension of 10 min. PCR products were spot ted on the membrane to make human testis cDNA microarray.

2.3 Screening of genes differentially expressed in fetal and adult testis

Total RNA of adult and fetal testes were extracted separately according to Trizol RNA isolation protocol (Gibco BRL, Grand Island, NY, USA) and quantified with a UV spectrometer. The Poly(A)⁺ mRNA was purified using an affinity column filled with poly (dT) resin (Qiagen, Hilden, Germany). The probes were prepared by incorporation of ³³P-labeled dATP in a reverse transcription reaction using 2 mL purified mRNA as the template, an oligo (dT) as the primer and moloney murine leukemin (M-MLV) reverse transcriptase. Each labeling reaction was carried out with 200 mCi [d-³³P]ATP following the manufacturer's instruction (NEN Life Science, Boston, MA, USA). Then the human testis cDNA microarray was hybridized with the ³³P-labeled human fetal and adult testis cDNA probes, respectively. The hybridization intensity of corresponding dots in adult and fetus were compared. If the difference of spot intensity in adult and fetus was more than 3-fold, higher or lower, this clone was considered as differentially expressed .

All differentially expressed cDNA plasmids were amplified, extracted and purified in mini-preps (QIAprep Spin Miniprep kit, Qiagen, Hilden, Germany). The full insert lengths were sequenced with an ABI auto-sequencer (model no. 377) at Huada Gene Center (Beijing, China). The sequences were then blasted in GenBank (http://www.ncbi.nlm.nih.gov) by using the software Blast (http://www.ncbi.nlm.nih.gov/blast) to determine the homology among various species and locations in chromosomes. The nucleic and deduced amino acid sequences were also analyzed by using Gene Runner and SMART software (http://smart.embl-heidelberg.de/) [10].

2.4 Tissue distribution of DPP8-v3 gene

After sequence identification and analysis, a gene highly expressed in adult testis, named DPP8-v3, was identified. The expression profile of this gene was determined by PCR followed by Southern-blot analysis. Multiple tissue cDNA panels were from commercial human multiple tissue cDNA (MTC) panel I and II kit (Cat#K1420-1 and K1421-1, Clontech), including 16 kinds of human tissues (heart, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas, spleen, thymus, prostate, testis, ovary, small intestine, colon and leukocytes). Primers were synthesized at BioAsia (Shanghai, China): P₁ 5'- GAGTCAACCACCGTTCAC -3', P₂ 5'- CTGTTTCC ATTGCTGCTG -3'. P₁, the upstream primer, was located at a specific 5' region of DPP8-v3 and P₂, the downstream primer, was in the common region of DPP8-v3 and its homologous genes. b-actin was used as the positive control of the cDNA templates, its upstream primer was 5'- CGGTTGGCCTTGGGGTTCAGGGGG -3' and downstream primer was 5'-ATCGTGGGGG CGCCCCAGGCACCA -3'. The PCR mixture (20 mL) contained 10 × PCR buffer 2 µL, 25 mmol/L Mg²⁺ 1.5 µL, 20 mmol/L dNTPs 0.15 µL, 5 U/µL Tag DNA polymerase 0.15 µL, 12.2 µL distilled water, 1 µL of each primer (5 pmol/µL), cDNA sample 2 µL. PCR was performed with an initial denaturation temperature at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 1 min and an additional extension at 72 °C for 7 min. PCR products were separated by electrophoresis on 1 % agarose gels and then transferred to Hybond TM-N⁺ nylon membranes (Amersham Pharmacia Biotech, Little Chalfont, Buckinghamshire, UK).

The DPP8-v3 cDNA probe was labeled with the same primers used for the PCR. The template was plasmid pTrip1E2 × with DPP8-v3 cDNA insert and Digoxigenin (Dig)-labeled dNTPs were used. Hybridization was performed according to the instruction manual of DIG High Prime DNA Labeling and Detection Starter Kit II (Cat.No.1585614, Roche Molecular Biochemicals, Indianapolis, IN, USA). The hybridization filter was pre-hybridized for 30 min at 48 °C in DIG Easy Hyb working solution, which was followed by 4 h hybridization with a denatured Dig-labeled DPP8-v3 probe. Then the filter was washed twice at room temperature in 2 × SSC-0.1 % SDS (5 min each), twice at 68 °C in 0.5 × SSC-0.1 % SDS (15 min each). Hybridization result was visualized with immunological detection through chemiluminescent substrate for alkaline phosphatase (CSPD).

2.5 Quantitative analysis of DPP8-v3 mRNA in different developmental stages of male testes

To compare the differential expression of the DPP8-v3 gene in different development stages of the testis, fluorescent RT-PCR was performed. cDNA of male testes included adult (deceased people aged 37-43 years) (n = 3) and fetal (accidentally aborted 6-month-old) testes' cDNA (n = 3). Primers were the same as we used in the experiment of tissue distribution of DPP8-v3 gene. Each reaction contained the cDNA template, 1 × SYBR Green PCR Master Mix (Applied Biosystems, Foster city, CA, USA) and 250 nmol/L of forward and reverse primers. The RT-PCR was performed using ABI PRISM 7000 Sequence Detection System (Applied Biosystems, Foster City, USA) following thermal cycling conditions: 5 min at 94 °C, 30 s at 94 °C, 30 s at 55 °C and 1 min at 72 °C with 40 cycles. b-actin was run in parallel with the same template as positive control under the same procedure. Statistically significant differences among the groups were determined by Stata 7.0 software (UCLA Academic Technology, Los Angeles, CA, USA). P < 0.05 was considered statistically significant.

3 Results

3.1 Hybridization of human testis cDNA microarray identified DPP8-v3 gene

After hybridization and data analysis, genes differentially expressed in human adult and fetal testes were considered as testis development and/or spermatogenesis-related. A clone, named DPP8-v3, was identified. This gene was highly expressed in adult testes compared with fetal testes. The hybridization signal intensities were approximately 5.52-fold higher in adult (40.15) than those in fetal testes (6.16) (Figure 1).

3.2 Sequence identification and analysis of DPP8-v3 gene

The full-length cDNA of DPP8-v3 gene is 3,030 bp and it contains an open reading frame (161-2857 nt) that encodes a protein with 898 amino acids. The methionine at 161-163 nt was the initiation site because there was an upstream stop code TGA at 158-160 nt (Figure 2). The cDNA sequence of this clone was deposited with GenBank (accession number AY354202).

Blast search revealed that DPP8-v3 was highly homologous to three other genes, all related to the homo sapiens DPP8 gene family identified in humans: DPP8 variant 1 (NM-130434), variant 2 (NM-017743) and variant 4 (NM-197961). Similar to DPP8-v3, these three transcripts are also localized in human chromosome 15 (NT-086827.1|Hs15-86498) and transcribed from an identical gene. Transcript and splicing comparison of DPP8-v3 with homologous genes indicated that the gene consists of 22 exons (Figure 3). Exon 2 was present only in DPP8-v3. Exon 3 was present in DPP8-v3 and DPP8 variant 4, exon 18 in DPP8-v3 and DPP8 variants 1 and 4, and exon 19 in DPP8-v3 and DPP8 variant 1. DPP8-v3 lacked exon 1 and presented exon 22 shorter than other homologous genes. Due to changes in specific nucleotides, the sequences of proteins differed.

3.3 Homologous comparison and predicted feature of DPP8-v3 peptide sequence

DPP8-v3 gene encoded an 898 amino-acid protein with predicted molecular weight 103 kDa and isoelectric point 5.62. Analysis of the amino acid sequence by using SMART software revealed that the DPP8-v3 protein has an N-terminal b-propeller and a C-terminal peptidase S9 domain located at amino acids 104-676 and 682-891, respectively (Figure 2).

Previous studies have shown that DPP8 was a member of the dipeptidyl peptidase IV (DPPIV)-like gene family [5]. Therefore, the amino acid sequence and conserved domain of DPP8-v3, DPP8 variants 1, 2 and 4 and human DPPIV were compared, which showed that various DPP8 peptidase shared 17.59 % identity and 67.26 % similarity with DPPIV. They all presented at least one of the N-terminal b-propeller domain and the C-terminal peptidase S9 domain, characteristics of the DPPIV peptidase (Figures 4 and 5).

3.4 Expression profile of DPP8-v3 gene

PCR amplification of cDNAs from different human tissues followed by Southern-blot analysis showed that DPP8-v3 gene was predominantly expressed in human testis and pancreas, weakly in the placenta and lung, almost imperceptibly in other organs (Figure 6).

3.5 Differential expression of DPP8-v3 in different development stages of male testis

Quantitative fluorescent RT-PCR indicated that the DPP8-v3 gene was differentially expressed in human adult and fetal testes. The expression level was quantified according to the number of cycles (Ct value) before entering the exponential phase in the PCR reaction. This value was conversely related to the input copies of transcript. The Ct value of the DPP8-v3 gene for human adult and fetal testes was 24.91 ± 0.16 and 34.24 ± 0.63, respectively; while the Ct value of b-actin, 18.34 ± 0.11 and 18.87 ± 0.80, respectively, was not significantly different between adult and fetal testes (Figure 7). So the expression level of the DPP8-v3 gene in human adult testes was significantly higher than that in fetal testis (P < 0.05). This result accurately verified the result of hybridization of cDNA microarray and revealed a correlation between DPP8-v3 expression and testicular development.

4 Discussion

In the present study, the testis cDNA microarray was used to identify the genes related to testis development and spermatogenesis [9]. A new gene, named DPP8-v3, was identified. The results not only showed that cDNA microarray was an efficient method to identify genes expression profiles, but also indicated that DPP8-v3 was a novel DPP8 transcript variant and may influence testis development/spermatogenesis by regulating immune state in testis.

The full length cDNA of DPP8 gene was first identified by Abbott et al. [5]. By analyzing its sequence, tissue distribution and biological activity, which showed the similarities between DPP8 and DPPIV in tissue expression pattern and substrates, DPP8 was considered a new member of the DPPIV-like gene family. Thus it was speculated that DPP8 has a potential role similar to DPPIV [5, 11]. DPPIV is a serine aminopeptidase with an ubiquitous tissue expression and significant upregulation on activated T-cell. In addition, human DPPIV is also known as the T-cell activation antigen CD26 [8, 12, 13]. A number of studies have indicated that DPPIV/CD26 is a key player in immunological processes and this role may involve both its enzyme activity and its non-catalytic activity, which is the ability to bind adenosine deaminase (ADA) [8, 14].

The tertiary structure of DPPIV contains an N-terminal b-propeller domain and a C-terminal peptidase S9 domain which perform ADA-binding and serine enzyme activity respectively (Figure 4). It has been proven that the non-catalytic activity of DPPIV, which binds to the soluble extracellular ADA, is able to reduce a local concentration of adenosine around T-cell and protect the T-cell from adenosine-mediated inhibition of proliferation. So DPPIV is considered as a costimulator of T-cell to participate in the immunoreaction [15, 16]. On the other hand, the role of enzyme activity of DPPIV within the immune system is gradually laid out. It was reported that DPPIV probably influenced chemotactic activity of some chemokines on Th2 lymphocytes and dendritic cells, but not on Th1 lymphocytes. These chemokines, including RANTES, eotaxin, monocyte drived chemokine (MDC) and stromal derived factor (SDF), share a conserved NH₂-X-Pro sequence (where X is any amino acid) at the NH₂ terminus, which conforms to the substrate specificity of DPPIV [17, 18]. Thus, DPPIV can mediate the N terminal truncation of these chemokines, resulting in alterations in their biologic activities, such as receptor specificity and chemotactic, potentially influence migration of Th2 lymphocyte and dendritic cells [11, 19, 20]. Thus it can be speculated that, during immunological process, DPPIV promotes T-cell proliferation and activation. Furthermore, it simultaneously regulates the chemotaxis of some lymphocyte to balance the intensity of immunoreaction.

Similarly, DPP8 has the same N-terminal b-propeller domain and a C-terminal peptidase S9 domain as DPPIV (Figure 4), which suggests that DPP8 is also the key player in immune regulation by its enzyme activity as well as no-catalytic activity. Furthermore, the immunoregulated role of DPP8 may be especially important in testes. Three different transcripts of the DPP8 gene have been identified: a major transcript of 5.0 kb and a minor transcript of 8.0 kb were present at either moderate or high levels in most examined tissues, including brain, liver, spleen, heart, testis, while a transcript of approximately 3.0 kb was detected only in the testis [5]. Thus, the testis was the only tissue to express these three DPP8 transcripts, suggesting that immunoregulation is particularly complicated in this tissue. This is in accordance with the accepted idea that immunoreaction must attain a balance between immune resistance and immune protection in testes, which contributes to the maintenance of normal spermatogenesis.

One more DPP8-related transcript variant has been identified in the present study (Figure 3). It is possible that the expression of the different transcript variants may be used to regulate the levels of active DPP8 protein [5]. The ability to immunoregulate diverse DPP8 transcript variants may be different in testes. For instance, DPP8 variant 2 only contains the N-terminal b-propeller domain and lacks the influence on chemotaxis of some lymphocyte. Thus, we speculate that the expression of so many DPP8 transcript variants, with different immunoregulation activity in the testis, may regulate the immunological level and stabilize the immune balance in the mass. More transcript variants may be found in the future and their biologic mechanisms need to be further explored.

Spermatogenesis begins at puberty, so genes highly expressed in adult testes should be related to spermatogenesis . Maintenance of immune balance is very important in the process of spermatogenesis, which implies DPP8 protein must be abundant in adult testes. The DPP8-v3 gene we have identified is just a novel DPP8 transcript variant highly expressed in adult testes, so it would play a key role in spermatogenesis and male fertility as a member of the DPP8 regulated network. Further study is required to provide more information and to obtain better understanding of the exact role and mechanism of action of DPP8-v3 in spermatogenesis.

Acknowledgment

The present work was supported by grants from China National 973 Program (No. G1999055901) and National Natural Science Foundation of China (No. 30170485).

References

1 Eddy EM. Male germ cell gene expression. Recent Prog Horm Res 2002; 57: 103-28.

2 Sharpe RM. Regulation of spermatogenesis. In: Knobil E, Neill J, editors. The Physiology of Reproduction. New York: Raven Press; 1994. p1363-434.

3 Billingham RE, Head JR. Current trends in reproductive immunology: an overview. J Reprod Immunol 1981; 3: 253-65.

4 Li WY. Reproductive immunology. In: Shi LY, Wang CN, Weng J, editors. Human Reproduction. Beijing: Scientific Publisher; 2002. p169-99.

5 Abbott CA, Yu DMT, Woollatt E, Sutherland GR, McCaughan GW, Gorrell MD. Cloning, expression and chromosomal localization of a novel human dipeptidyl peptidase (DPP) IV homolog, DPP8. Eur J Biochem 2000; 267: 6140-50.

6 Morimoto C, Schlossman SF. The structure and function of CD26 in the T-cell immune response. Immunol Rev 1998; 161: 55-70.

7 Schrader WP, West CA, Miczek AD, Norton EK. Characterization of the adenosine deaminase-adenosine deaminase complexing protein binding reaction. J Biol Chem 1990; 265: 19312-8.

8 Abbott1 CA, McCaughan GW, Levy MT, Church WB, Gorrell MD. Binding to human dipeptidyl peptidase IV by adenosine deaminase and antibodies that inhibit ligand binding involves overlapping, discontinuous sites on a predicted beta propeller domain. Eur J Biochem 1999; 266: 798-810.

9 Sha J, Zhou Z, Li J, Yin L, Yang H, Hu G, et al. Identification of testis development and spermatogenesis-related genes in human and mouse testis using cDNA arrays. Mol Hum Reprod 2002; 8: 511-7.

10 Zhou ZM, Sha JH, Li JM, Lin M, Zhu H, Zhou YD, et al. Expression of a novel reticulon-like gene in human testis. Reproduction 2002; 123: 227-34.

11 von Bonin A, Huhn J, Fleischer B. Dipeptidyl-peptidase IV/CD26 on T cells: analysis of an alternative T-cell activation pathway. Immunol Revs 1998; 161: 43-53.

12 Kajiyama H, Kikkawa F, Suzuki T, Shibata K, Ino K, Mizutani S. Prolonged survival and decreased invasive activity attributable to dipeptidyl peptidase IV overexpression in ovarian carcinoma. Cancer Research 2002; 62: 2753-7.

13 Wesley BUV, Albino AP, Tiwari S, Houghton AN. A role for dipeptidyl peptidase IV in suppressing the malignant phenotype of melanocytic cells. J Exp Med 1999; 190: 311-22.

14 Proost P, Struyf S, Schols D, Opdenakker G, Sozzani S, Allavena P, et al. Truncation of macrophage-derived chemokine by CD26/dipeptidyl peptidase IV beyond its predicted cleavage site affects chemotactic activity and CC chemokine receptor 4 interaction. J Biol Chem 1999; 274: 3988-93.

15 Dong RP, Kameoka J, Hegen M, Tanaka T, Xu Y, Schlossman SF, et al. Characterization of adenosine deaminase binding to human CD26 on T cells and its biologic role in immune response. J Immunol 1996; 156: 1349-55.

16 Dong RP, Tachibana K, Hegen M, Munakata Y, Cho D, Schlossman SF, et al. Determination of adenosine deaminase binding domain on CD26 and its immunoregulatory effect on T cell activation. J Immunol 1997; 159: 6070-6.

17 McCaughan GW, Gorrell MD, Bishop GA, Abbott CA, Shackel NA, McGuinness PH, et al. Molecular pathogenesis of liver disease: an approach to hepatic inflammation, cirrhosis and liver transplant tolerance. Immunol Rev 2000; 174: 172-91.

18 Pereira DA, Gomes L, El-Cheikh MC, Borojevic R. Dipeptidyl peptidase IV (CD26) activity in the hematopoietic system: differences between the membrane-anchored and the released enzyme activity. Braz J Med Biol Res 2003; 36: 567-78.

19 Shioda T, Kato H, Ohnishi Y, Tashiro K, Ikegawa M, Nakayama EE, et al. Anti-HIV-1 and chemotactic activities of human stromal cell-derived factor 1alpha (SDF-1alpha) and SDF-1beta are abolished by CD26/dipeptidyl peptidase IV-mediated cleavage. Proc Natl Acad Sci USA 1998; 95: 6331-6.

20 Proost P, De Meester I, Schols D, Struyf S, Lambeir AM, Wuyts A, et al. Amino-terminal truncation of chemokines by CD26/dipeptidyl-peptidase IV. Conversion of RANTES into a potent inhibitor of monocyte chemotaxis and HIV-1-infection. J Biol Chem 1998; 273: 7222-7.