This web only provides the extract of this article. If you want to read the figures and tables, please reference the PDF full text on Blackwell Synergy. Thank you.
- Original Article -
Effect of 43°C treatment on expression of heat shock proteins
105, 70 and 60 in cultured monkey Sertoli cells
Min Chen, Jin-Xiang Yuan, Yu-Qiang Shi, Xue-Sen Zhang, Zhao-Yuan Hu, Fei Gao, Yi-Xun Liu
State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China
Abstract
Aim: To examine the possible effect of heat treatment on expression of heat shock proteins (Hsps) 105, 70, and 60
in primary monkey Sertoli cells and to evaluate the possible signal pathways.
Methods: Western blot analysis, real-time polymerase chain reaction (PCR), and confocal immunohistochemistry were used to analyze mRNA and protein
levels of the Hsps in response to 43ºC treatment of Sertoli cells isolated from pubertal monkey testes.
Results: Staining with Hoechst 33342 indicated Sertoli cells did not undergo apoptosis after heat treatment. Hsp105 was
expressed in cytoplasm of untreated Sertoli cells. Both Hsp105 mRNA and protein levels were increased
approximately 20-fold compared to those of the untreated controls at 12 h after heat treatment. Untreated Sertoli cells did not
express Hsp70, but heat stress induced its expression in the cell cytoplasm. The time-course of changes in Hsp70
was similar to that of Hsp105. In contrast to Hsp105 and Hsp70, the change in Hsp60 expression was much less
obvious. The protein level between 12 h and 48 h after heat treatment was only approximately 1.5-fold that of the
untreated control. Extracellular regulated kinase (ERK) 1/2 inhibitor (U0126) or phosphoinositide kinase-3 (PI3K)
inhibitor (LY294002) could partially block the response of Hsp105 and Hsp70 induced by heat treatment.
Conclusion: These results indicate that the heat-induced expression of the three types of Hsp in monkey Sertoli cells might be
regulated by ERK and/or PI3K signal pathways, but the profile of their expression is different, suggesting that they
might have different regulatory functions in Sertoli
cells. (Asian J Androl 2008 May; 10: 474_485)
Keywords: Hsp105; Hsp70; Hsp60; Sertoli cells; heat treatment; monkey
Correspondence to: Prof. Yi-Xun Liu, State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences,
Beijing 100101, China.
Tel: +86-10-6480-7038 Fax: +86-10-6480-7583
E-mail: liuyx@ioz.ac.cn
Received 2007-09-18 Accepted 2008-01-12
DOI: 10.1111/j.1745-7262.2008.00391.x
1 Introduction
Mild hyperthermia leads to cessation of spermatogenesis [1]. Experimental cryptorchidism or local testicular heat
treatment with 43ºC water induced reversible oligospermia or azoospermia in rodents and monkeys by increased germ
cell apoptosis [2_4]. Sertoli cells are the only somatic cells in seminiferous tubules that surround spermatogenic cells
at various stages of development. It is well known that spermatogenic cells rely on Sertoli cells for structural and
nutritional support [5, 6]. Unlike germ cells, the population of Sertoli cells is not affected by heat treatment and the
protective mechanism is not known [2].
Physiological stress such as heat shock, hypoxia, ischemia and heavy metals can result in the synthesis of a group
of highly conserved proteins, termed heat shock proteins (Hsps), in prokaryotic and eukaryotic organisms [7, 8].
Hsps are capable of protecting cells from harmful effects of stress by repairing denatured proteins or promoting
damaged protein degradation, and they are implicated to function at key regulatory points in the control of cell
apoptosis [9]. Mammalian cell Hsps have been
classified into six major families according to their molecular
size: small stress proteins; Hsp40; Hsp60; Hsp70; Hsp90;
and Hsp110 families [10]. Evidence has shown that most
Hsps are expressed in normal unstressed cells as
molecular chaperones assisting in the folding/unfolding,
assembly/disassembly, and transport of various proteins
[11]. In testis, different members of Hsp families, such
as the Hsp110, Hsp70, and Hsp60 families, are found to
be expressed, and might play important roles in
spermatogenesis. Three members of the Hsp110 family, ATP and
peptide-binding protein in germ cells (Apg)-1, Apg-2 and
Hsp105 (Hsp110), were observed to be expressed in adult
human testis at high, moderate and low levels,
respectively [12]. Hsp70-2 and Hsp70t, two members of the
Hsp70 family, were constitutively expressed in germ cells
and regulated developmentally. Hsp70-2 is specifically
expressed in late primary spermatocyte (from pachytene
stage onward) and early spermiogenesis (steps 1_7) [13,
14], whereas Hsp70t is mainly expressed in early round
spermatids [15]. Hsp60 is expressed in Sertoli cells,
Leydig cells, spermatogonia, leptotene and zygotene
spermatocytes in testis of rat [16], human and macaque
monkey [17]. It has been shown that decrease in
expression of Hsp60 [18] or Hsp70-2 [19] in germ cells is
consistent with male infertility.
Expression of most Hsps in germ cells is uninducible
in response to heat stress. Our early in
vivo studies showed that Hsp105 [20] or Hsp70-2 [21, 22]
expression in germ cells declined after 43ºC local warming of
testes or experimental cryptorchidism in monkeys and
rats. Inducible Hsp70, another member of the Hsp70
family, was found to be unaffected by elevated
temperature in germ cells [23_26]. Although Hsp60 expression
was upregulated in spermatogonia, unlike other types of
germ cells, spermatogonia did not undergo apoptosis
after heat treatment [20]. The uninducibility of Hsp
expression in most germ cells might be closely related to
the susceptibility of germ cells after heat [23, 27]. In
contrast to germ cells, Sertoli cells survive after heat
stress. Whether Sertoli cells protect themselves against
heat stress by upregulating Hsp expression is not clear.
No evidence of expression and regulation of Hsps in
primary Sertoli cells in response to heat treatment has been
reported. There are only a few in vitro studies using
Sertoli cell lines [28, 29]. Considering the high
homology and similarity of rhesus monkey to human in
physiology and biochemistry, we used pubertal rhesus
monkey testes for primary Sertoli cell preparation. We
examined the effect of the well-defined 43ºC treatment on
the expression of three representative Hsps, Hsp105,
inducible Hsp70 and Hsp60, which belong to three
different Hsp families, and also evaluated the possible
involvement of signal pathways on their regulation.
2 Materials and methods
2.1 Antibodies and reagents
The polyclonal antibodies against Hsp105 (sc-6242),
Hsp70 (sc-1060), and Hsp60 (sc-1052) were from Santa
Cruz Biotechnology (Santa Cruz, CA, USA). The
monoclonal antibody against β-actin was from Sigma (St.
Louis, MO, USA). Protein kinase A (PKA) inhibitor (H89),
extracellular regulated kinase (ERK)1/2 inhibitor (U0126),
p38 mitogen-activated protein kinase (MAPK) inhibitor
(SB203580), phosphoinositide kinase-3 (PI3K) inhibitor
(LY294002), protein kinase C (PKC) activator (phorbol
myristate acetate, PMA), collagenase type IV, Dnase
I, and trypsin were purchased from Sigma (St.
Louis, MO, USA). Brilliant SYBR Green QPCR Master Mix was
purchased from Stratagene (La Jolla, CA, USA).
2.2 Animals
The male pubertal (4_5-year-old) rhesus monkeys
used for preparation and culture of the Sertoli cells were
from Beijing Tiantan Biological Products Corporation
LTD. (Beijing, China). They were healthy and killed for
preparation of the special biological reagents. The use
of these monkeys was approved by the Institutional
Committee on Animal Care and Use of the Ministry of Health
of China. All the protocols had the approval
of the Institutional Committee on Animal Care and Use.
2.3 Preparation of rhesus monkey Sertoli cells
After anesthesia with pentobarbital sodium
(30 mg/kg body weight, i.v.), testes were obtained from three
pubertal rhesus monkeys (4_5 years old) each time using
an aseptic technique. A total of nine monkeys were used
for this experiment. For preparation of the Sertoli cells,
after being washed in cold (0_4ºC)
phosphate-buffered saline (PBS) three or four times, the individual testis was
taken back in cold PBS (pH 7.4, containing
100 U/mL penicillin and 100 μg/mL streptomycin sulfate). Isolation and
purification of the Sertoli cells was complete 2_3 h after
the castration.
Sertoli cells were prepared as described [30] with
modifications. Briefly, the individual testis was washed
several times and decapsulated prior to being minced into
approximately 2 mm pieces. The minced tissues were
suspended in cold PBS and shaken vigorously by hand.
Seminiferous tubules were recovered after
sedimentation at unit gravity for 5 min at 4ºC. The wash and
sedimentation were repeated another three times to remove
red blood cells and Leydig cells. The pellets were then
incubated in a PBS solution of 10-fold volume
containing 1 mg/mL collagenase IV and 75 U/mL Dnase
I at 33ºC in a shaking water bath (160 oscillations/min) for 30 min
and monitored closely to limit clumping of tissue that
can result from overdigestion. After digestion, if there
were still undigested seminiferous tubules, they were
removed to another tube(s) for digestion again with the
same enzymes for less than 20 min. After the tissue
clusters resulting from the enzyme digestion were discarded, the suspensions were centrifuged for 4 min
at 90 × g and the pellets were washed with Dulbecco's
Modified Eagle's Medium(DMEM)/F12 two or three times. The second digestion was carried out in a PBS
solution containing 0.25% trypsin and 75 U/mL Dnase
I for less than 8 min at room temperature. On completion
of digestion, fetal bovine serum (FBS) was added to the
suspension to terminate the digestion. The suspensions
were filtered through an 80 mesh stainless steel filter
before being centrifuged for 5 min at 180 ×
g. The cells were washed twice with DMEM/F12, suspended in
DMEM/F12 supplemented with 10% FBS, and cultured at 33ºC in a
CO2 incubator (5% CO2 : 95% air). After
40 h of culture, the medium was replaced to remove most
unattached germ cells. The cells were digested with
trypsin (0.05%) after an additional 12_24 h. The
isolated cells from each testis were frozen in liquid nitrogen
for use of later primary culture.
2.4 Primary monkey Sertoli cell cultures
After they were thawed, the cells were plated in
35 mm dishes in DMEM/F12 with 10% FBS. The
density was
0.2 × 106/cm2 for protein and RNA extractions.
For confocal immunohistochemistry, the cells were seeded onto 24 mm × 24 mm coverslips placed in 35 mm
dishes at a density of
0.07 × 106/cm2
. Twenty-four hours later, the cells were hypotonically treated with 20 mmol
Tris (pH 7.4, 22ºC) for 3 min to lyse the residual amount
of germ cells. The cells were then incubated with
DMEM/F12 without FBS for 24 h before
treatments.
For the cell heat treatment, the dishes containing the
cells were sealed with paraffin membrane and put in a
sterile 43ºC water bath for 30 min. Then the dishes were
immediately put back into the 33ºC
CO2 incubator. The time immediately after completing the 30 min heat
treatment was designated as 0 min. At various time points
between 30 min and 5 days (5D), the cell cultures were
terminated and analyzed.
To analyze the effects of various protein kinase
inhibitors or activator on heat-induced Hsp expression, the
Sertoli cells were pretreated with PKA inhibitor H89
(10 µmol), ERK1/2 inhibitor U0126 (10 µmol), p38
MAPK inhibitor SB203580 (20 µmol), PI3K inhibitor
LY294002 (20 µmol), or PKC activator PMA
(10_7 mol) for 30 min before the 43ºC treatment and the cells were
collected 24 h after heat stress. The doses used here
were according to the results of our previous
experiments in granulosa cells [31, 32] and Sertoli cells [33,
34].
2.5 Detection of cell apoptosis with Hoechst 33342 staining
Untreated Sertoli cells or heat-treated cells (at 24 h
after terminating the 30-min 43ºC warming) were
collected for analysis of apoptosis with Hoechst 33342
staining. After two washes with PBS, the Sertoli cells
were fixed in freshly prepared mixture of methanol and
acetone (1:1) for 15 min at room temperature, followed
by three washes with PBS, and incubation in
100 μg/mL Hoechst 33342 at room temperature in the dark for
15 min. After being washed in PBS, the cells were
examined by confocal laser scanning microscope (Carl
Zeiss, Thornwood, NY, USA).
2.6 Western blot analysis
After two washes with PBS, the Sertoli cells were
lysed in cold lysis buffer (PBS containing 1% Nonidet
P-40, 0.5% sodium deoxycholate, and 0.1% sodium dodecyl
sulfate [SDS] supplemented with 100 μg/mL
phenylmethylsulfonyl fluoride and 1 μg/mL aprotinin). After
centrifugation at 13 000 × g for 20 min, the
supernatants were collected and the total protein concentrations
were determined by spectrophotometer, using bovine
serum albumin as a standard. Fifty micrograms of total
protein per lane was separated by 10%
SDS-polyacrylamide gel (SDS-PAGE) electrophoresis and transferred
to the nitrocellulose membranes (Bio-Rad Laboratories,
Hercules, CA, USA). After blocking in 5% non-fat milk
in 0.09% NaCl, 0.05% Tween-20, and 100 mmol/L
Tris-HCl (pH 7.5) for 1 h at room temperature, the membranes
were incubated with the primary antibodies Hsp105
(1:800), Hsp70 (1:400), Hsp60 (1:800), and β-actin (1:5
000) in blocking solution for 2 h at room temperature or at
4ºC overnight. The membranes were washed three times
then incubated with the corresponding
peroxidase-conjugated secondary antibodies (1:2 500) for 1 h at room
temperature. Reactive bands were visualized by
Super-Signal West Pico chemiluminescent substrate (Pierce,
Rockford, IL, USA) and the membranes were then subjected to X-ray autoradiography. Band intensities were
determined by Quantity One software (Bio-Rad).
2.7 Confocal immunohistochemistry
After two washes with PBS, the Sertoli cells were
fixed in a freshly prepared mixture of methanol and
acetone (1:1) for 15 min at room temperature, followed by
three washes with PBS, and incubation in 3% bovine
serum albumin for 1 h. Then the cells were
immunolabeled with the primary antibody (1:150) for 2 h, and
the corresponding fluorescein isothiocyanate-conjugated
immunoglobulin G (1:200) for 1 h at room temperature.
After three washes in PBS, propidium iodide (PI)
incubation for 10 min was used to dye the nuclei. Finally,
the cells were analyzed by confocal laser scanning
microscope (Carl Zeiss, Thornwood, NY, USA). For the
negative controls, the cells were processed without the
primary antibodies, replaced with the normal
immunoglobulin G.
2.8 Real-time polymerase chain reaction (PCR)
A two-step, real-time reverse transcription-PCR was
used to measure the expression of the candidate genes.
Total cell RNA was isolated with TRIzol reagent (Invitrogen, CA, USA) according to the instructions of
the manufacturer and quantified by measuring absorbance
at 260 nm. Total RNA (2 μg) was reverse-transcribed
into cDNA in a 20 mu;L reaction containing Superscript III
reverse transcriptase (Invitrogen, San Diego, CA, USA),
oligo(dT), dNTPs and RNase inhibitor, followed by
dilution with RNase-free water in the ratio of 1:4. The
primers specific to the candidate genes were designed
using Primer 3 software. The primer pairs were designed
as follows (5'_3'): Hsp105 sense,
AAAGTTGACCAGCCTCCAGA and antisense,
TGGTCCACACAGCTTGTCTC (228 bp); Hsp70 sense,
CGACCTGAACAAGAGCATCA and antisense,
AAGATCTGCGTCTGCTTGGT (213 bp); Hsp60 sense,
CATTCCAGCCTTGGACTCAT and antisense, TCACAACCTTTGTTGGGTCA
(236 bp); and ribosomal protein L32 (rpl32) sense,
GCCCAAGATCGTCAAAAAGA and antisense, GTTGCACATCAGCAGCACTT (250 bp). Rpl32 encodes a
ribosomal protein that is a component of the 60S subunit,
and this gene is one of the most stably expressed genes
in most cells. Real-time PCR was carried out in a
96-well plate using an ABI Prism 7000 sequence detection
system (Applied Biosystems, Foster City, CA, USA). The
previously synthesized cDNA was used as the template.
Reactions for each time point were carried out in
triplicate and in a 20 μL reaction mixture containing
2 μL cDNA, 12.5 μL 2 × SYBR Green Master Mix, and 150
nmol of each reverse and forward primer specific for
the candidate genes. Reactions were run for 40 cycles
(95ºC for 30 s, 58ºC for 1 min, 72ºC for 1 min)
following an initial 10 min step at 95ºC. The threshold cycle
(CT), which indicates the relative abundance of a
particular transcript, was calculated for each reaction by
the ABI Prism 7000 sequence detection system (Applied
Biosystems). The CT values of rpl32 were used as
endogenous controls. The relative concentration of the
candidate gene expression was calculated using the
formula 2_ΔΔCT as described in the SYBR Green user manual,
thus the concentration of the control sample was 1.
Real-time PCR quantification of gene expression levels in each
sample was the mean of triplicate real-time PCR experiments. For each time point, values are presented
as the mean ± SEM of triplicate independent experiments.
All gene expression levels were normalized to rpl32
expression levels.
2.9 Data analysis and statistics
All monkey Sertoli cell culture experiments were
repeated at least three times by using three different
monkey cell preparations. The quantitative results were
represented as the means ± SEM. Statistical analysis was
carried out with spss (version 13.0; SPSS, Chicago, IL,
USA), and one-way ANOVA was used for analyzing the
data in different groups. P < 0.05 were considered as
significant. For the confocal immunohistochemistry data,
one representative picture of three similar results from three
separate experiments is presented.
3 Results
3.1 Purity of primary monkey Sertoli cell preparations
Purity of the Sertoli cells was evaluated by confocal
immunohistochemistry of Wilms' tumor gene 1 (WT1).
Transcription factor WT1 is specifically expressed in
Sertoli cells in testis. It is a stable marker of Sertoli cells
and its expression is switched on from early fetal life and
maintained throughout the whole of life [35].
As shown in Figure 1A, WT1 was specifically expressed in the nuclei of monkey Sertoli cells. The purity
of Sertoli cell preparations was 91.400% ± 0.021,
calculated from three different experiments using three
different Sertoli cell preparations.
3.2 Sertoli cells after 43ºC treatment did not undergo
apoptosis
We observed whether Sertoli cells underwent apoptosis with Hoechst 33342 staining. As shown in
Figure 1B, the morphological changes of the nuclei,
including condensation, ripple, or fragmentation, were not
observed, suggesting no obvious cell apoptosis in the
heat-treated or untreated Sertoli cells, indicating that 43ºC
treatment did not induce Sertoli cell apoptosis.
3.3 Hsp105 mRNA and protein levels increased in
primary monkey Sertoli cells after 43ºC treatment
The untreated monkey Sertoli cells expressed Hsp105.
After the cells were incubated in 43ºC water for 30 min,
as shown in Figure 2A, 2B, both their mRNA and protein
increased in a time-dependent manner. The maximums
were reached 12 h after terminating the heat treatment,
with approximately 20-fold increases compared with the
untreated control (P < 0.01). Both the mRNA and
protein levels then gradually decreased and returned to basal
levels at 72 h and 5D, respectively.
The confocal immunohistochemistry showed that Hsp105 was mainly expressed in the cytoplasm of the
Sertoli cells. The heat treatment did not affect its
localization (Figure 3A). The quantitative change in its
expression was similar to that observed with Western blot
analysis.
3.4 Hsp70 expression induced in primary monkey Sertoli
cells by 43ºC treatment
There was no Hsp70 expression in the untreated
Sertoli cells, but heat stress induced its expression. The
temporal changes in mRNA and protein resembled those
of Hsp105, with the maximum level at 12 h after
terminating the heat treatment (P < 0.01), as shown in Figure
4A, 4B. The mRNA level then gradually decreased in a
time-dependent manner. The protein, however, remained
at the high level between 12 h and 72 h, then decreased
until 5D when it reached an undetectable level.
No positive staining of Hsp70 in the untreated Sertoli
cells was observed, whereas expression clearly appeared
in the cytoplasm at 12 h after heat treatment and did not
disappear until 5D (Figure 3B).
3.5 Hsp60 expression in primary monkey Sertoli cells after
43ºC treatment
Compared with Hsp105 and Hsp70, the changes in Hsp60 expression in response to heat treatment were
much less obvious. Its mRNA level was higher than the
untreated control between 6 h and 24 h after terminating
the heat treatment (P < 0.05) (Figure 5A). The Hsp60
protein level only increased approximately 1.5-fold at 12 h
after the treatment (P < 0.05). This level remained until
48 h, then decreased to the control level at 72 h, earlier
than that of Hsp105 and Hsp70 (Figure 5B).
The immunohistochemistry result showed that Hsp60
was not expressed in the nuclei of Sertoli cells. Its
location was confined to the area surrounding the nuclei and
its expression between 12 and 48 h was slightly higher
than the untreated control (Figure 3C).
3.6 U0126 or LY294002 inhibited heat-induced Hsp105
and Hsp70 expression
PKA inhibitor H89, ERK1/2 inhibitor U0126, p38 MAPK inhibitor SB203580, PI3K inhibitor LY294002, and
PKC activator PMA were used to further clarify which
signal pathway could be involved in heat-induced Hsp
expression in Sertoli cells. In our previous experiments
we have examined the possible toxic effect of these
compounds and the relevant solvents on granulosa [31, 32]
and Sertoli cell functions [33, 34] in the doses used for
this experiment. No obvious negative effect could be
observed. The results of Western blot analysis (Figure
6A) and confocal immunohistochemistry (Figure 6B, 6C)
showed that U0126 significantly inhibited the induction
of Hsp105 and Hsp70 expression in response to heat
treatment. A partial inhibitory effect of LY294002 on
heat-induced Hsp105 and Hsp70 expression was also observed, whereas the protein levels were still higher than
the untreated controls (Hsp105, P < 0.05; Hsp70,
P < 0.01). H89, SB203580, and PMA did not have an obvious effect.
These results indicate that heat-induced Hsp expression
in monkey Sertoli cells might be regulated by the ERK
and/or PI3K signal pathways.
4 Discussion
Hsps are among the most conserved proteins known
to be expressed in normal cells or induced by various
harmful conditions. They serve as molecular chaperones,
helping to correct folding of newly synthesized proteins,
protein oligomerization, and intracellular translocation. In
stress conditions, they are capable of refolding denatured
proteins or degrading them [36]. It has been suggested
that production of Hsps might be necessary for cell
survival against apoptosis and recovery of cells from stress
[37, 38].
In this study, we have selectively examined
expression of Hsp105, Hsp70, and Hsp60, members of three
different Hsp families, in primary monkey Sertoli cells.
We showed that Hsp105 and Hsp60 were expressed in untreated control Sertoli cells, whereas Hsp70 was not.
The expression of these three Hsps in the untreated
Sertoli cells (maintained at 33ºC) was not altered along the
same time points as the groups treated by 43ºC (data not
shown). The heat treatment significantly induced
expression of Hsp105 and Hsp70, but only a slightly
increased expression of Hsp60 was observed. In our
previous in vivo studies on monkey testes, we observed
that Hsp105 expression in spermatids decreased
dramatically with the loss of spermatids on days 3, 8 and 30
after 43ºC treatment, and returned to the baseline levels
on days 84 and 144. In contrast, the expression of Hsp60
increased on days 3, 8 and 30 and was only detected
in Sertoli cells and spermatogonia. Temporal changes
in the expression pattern of Hsp105 and Hsp60 in
relation to germ cell death suggested that they might be
involved in the key processes in regulation of germ
cell apoptosis [20].
Hsp105 is also denoted as Hsp110 [10]. Hsp105,
Apg-1, and Apg-2 constitute the Hsp110 family. Anti-Hsp105
antibody used in our studies detects Hsp105 and also
cross-reacts, to a lesser extent, with Apg-1 and Apg-2.
Apg-2 expression is ubiquitous in various mouse tissues
and is most abundant in testis and ovary. Its expression
is not induced by heat treatment, suggesting that it might
play a role under non-stress conditions [28]. Therefore,
the changes in Hsp105 expression observed in the
Sertoli cells after heat treatment in our study, to some extent,
might be changes in Hsp105 and Apg-1 expression.
Apg-1 has been reported expressed in germ cells, but not in
testicular somatic cells, in mouse and human. In testis
without germ cells (Sertoli-cell-only syndrome) or
arrested at spermatogonia, staining of Apg-1 was absent
[39]. When the TAMA26 Sertoli cell line was transferred from 32ºC to 39ºC for 2 h, Apg-1 transcript was
induced, but the induction did not occur with a
temperature shift from 32ºC to 42ºC. The induction of Hsp105
in the TAMA26 Sertoli cell line was similar to Apg-1 [29].
However, in the present study, we observed Hsp105 expression was significantly induced at 12 h after
incubating the primary monkey Sertoli cells at 43ºC for 30 min,
and its expression at 72 h was still higher than that of
untreated control cells. The different heat treatment (42ºC
for 2 h vs. 43ºC for 30 min), cell collection time
(immediately after treatment vs. 30 min_5D after treatment),
or cell types (mouse cell line vs primary monkey cells)
might account for the different results.
The Hsp70 family comprises at least eight highly
homologous members that differ in intracellular
localization and expression pattern [40]. It is known that
Hsp70-2 and Hsp70t are constitutively expressed in testis. They
are not inducible in germ cells [41_43]. Hsp70-1A and
Hsp70-1B are collectively referred to as Hsp70, often
called major stress-inducible Hsp70 [44]. Because of its
inducibility, it was chosen for our experiment. Inducible
Hsp70 has been found to have multiple roles in cytoprotection against apoptosis by reducing or
blocking caspase activation and suppressing mitochondrial
damage and nuclear fragmentation [45, 46]. High
expression of Hsp70 is also a prerequisite for survival of
human cancer cells of various origin [47, 48]. Although
Allen et al. [49, 50] found that Hsp70 was induced in
germ cells by heat stress, more recent studies indicated
that Hsp70 could not be induced in germ cells [23_26].
In primary monkey Sertoli cells, however, we showed
that Hsp70 was significantly induced by the 43ºC
treatment.
Hsp60 has been reported as essential for correcting
folding of nuclear-encoded proteins imported to
mitochondria [51]. The concentration of Hsp60 has been
found to correlate well with mitotic activity of
spermatogonia [16]. We observed that, after heat treatment, Hsp60
in Sertoli cells was only approximately 1.5-fold that of
the untreated control, which is consistent with an earlier
report [43], suggesting that Hsp60 might function more
as a chaperone and less as a heat-inducible protein.
Protein kinases and kinase pathways form highly
interactive networks to achieve the integrated function of
cells. They play important roles in regulation of cell
proliferation, differentiation, and survival [52, 53]. Our
earlier reports showed that heat-induced cytokeratin
(ck)-18 re-expression in adult monkey Sertoli cells could be
blocked by a PKA or an ERK1/2 inhibitor. The 43ºC
treatment of monkey testes is capable of activating Akt,
a key effector of PI3K. However, ck-18 induction in
Sertoli cells remained unaltered when the PI3K/Akt
pathway was blocked [34]. In the present study,
heat-induced Hsp105 and Hsp70 expression could be partially
blocked by the inhibitor of ERK1/2 or PI3K, but not by
the inhibitor of PKA, suggesting that heat stress
regulates the expression of different molecules in Sertoli cells
through different pathways.
In conclusion, this study has shown for the first time,
to our knowledge, that 43ºC treatment of primary
monkey Sertoli cells could induce differential expression of
Hsp105, Hsp70, and Hsp60 in the cells, which might be
regulated by the ERK and/or PI3K signal pathways. The
profiles of Hsp expression in Sertoli cells after heat
treatment are different from those in germ cells, as reported
earlier. The induced Hsp expression might help Sertoli
cells survive the stress condition. However, we have no
direct evidence from the present study. Further research,
for example, suppressing Hsp gene expression with short
interfering RNA or blocking their protein functions with
specific inhibitors or antibodies, is needed. Our earlier
studies showed that 43ºC treatment could induce
re-expression of ck-18 and liver receptor homolog-1 (LRH-1)
in Sertoli cells, and this might be regarded as a
dedifferentiation feature [34, 54]. The induced Hsp expression
might also play a role in the processes of regulation, but
this also needs further investigation.
Acknowledgment
This study was supported by
the "973" project (No. 2006CB504001), the Major Research Plan (No.
2006CB944001), the CAS Innovation Project (KSCA2-YW-R-55), the National Natural Science Foundation of
China (No. 30618005;30230190; 30600311), and the Beijing Natural Science Foundation (No. 5073032).
References
1 Kormano M. Development of the rectum_testis temperature
difference in the post-natal rat. J Reprod Fertil 1967; 14:
427_37.
2 Tao SX, Guo J, Zhang XS, Li YC, Hu ZY, Han CS,
et al. Germ cell apoptosis induced by experimental cryptorchidism is
mediated by multiple molecular pathways in cynomolgus
macaque. Front Biosci 2006; 11: 1077_89.
3 Lue YH, Hikim AP, Swerdloff RS, Im P, Taing KS, Bui T,
et al. Single exposure to heat induces stage-specific germ cell
apoptosis in rats: role of intratesticular testosterone on stage
specificity. Endocrinology 1999; 140: 1709_17.
4 Lue YH, Lasley BL, Laughlin LS, Swerdloff RS, Hikim AP,
Leung A, et al. Mild testicular hyperthermia induces
profound transitional spermatogenic suppression through increased
germ cell apoptosis in adult cynomolgus monkeys
(Macaca fascicularis). J Androl 2002; 23: 799_805.
5 Griswold MD. Interactions between germ cells and Sertoli
cells in the tesis. Biol Reprod 1995; 52: 211_6.
6 Huleihel M, Lunenfeld E. Regulation of spermatogenesis by
paracrine/autocrine testicular factors. Asian J Androl 2004; 6:
259_68.
7 Lindquist S. The heat-shock response. Annu Rev Biochem
1986; 55: 1151_91.
8 Morimoto RI. Cells in stress: transcriptional activation of
heat shock genes. Science 1993; 259: 1409_10.
9 Jolly C, Morimoto RI. Role of the heat shock response and
molecular chaperones in oncogenesis and cell death. J Natl
Cancer Inst 2000; 92: 1564_72.
10 Easton DP, Kaneko Y, Subjeck JR. The hsp110 and Grp170
stress proteins: newly recognized relatives of the Hsp70s.
Cell Stress Chaperones 2000; 5: 276_90.
11 Craig EA, Gambill BD, Nelson RJ. Heat shock proteins:
molecular chaperones of protein biogenesis. Microbiol Rev
1993; 57: 402_14.
12 Nonoguchi K, Itoh K, Xue JH, Tokuchi H, Nishiyama H, Kaneko
Y, et al. Cloning of human cDNAs for Apg-1 and
Apg-2, members of the Hsp110 family, and chromosomal assignment of
their genes. Gene 1999; 237: 21_8.
13 Krawczyk Z, Mali P, Parvinen M. Expression of a
testis-specific hsp70 gene-related RNA in defined stages of rat
seminiferous epithelium. J Cell Biol 1988; 107: 1317_23.
14 Dix DJ, Rosario-Herrle M, Gotoh H, Mori C, Goulding EH,
Barrett CV, et al. Developmentally regulated expression of
Hsp70-2 and a Hsp70-2/lacZ transgene during
spermatogenesis. Dev Biol 1996; 174: 310_21.
15 Matsumoto M, Fujimoto H. Cloning of a hsp70-related gene
expressed in mouse spermatids. Biochem Biophys Res
Commun 1990; 166: 43_9.
16 Meinhardt A, Parvinen M, Bacher M, Aumuller G, Hakovirta
H, Yagi A, et al. Expression of mitochondrial heat shock
protein 60 in distinct cell types and defined stages of rat
seminiferous epithelium. Biol Reprod 1995; 52: 798_807.
17 Meinhardt A, Seitz J, Arslan M, Aumuller G, Weinbauer GF.
Hormonal regulation and germ cell-specific expression of heat shock
protein 60 (hsp60) in the testis of macaque monkeys
(Macaca mulatta and M. fascicularis). Int J Androl 1998; 21: 301_7.
18 Werner A, Meinhardt A, Seitz J, Bergmann M. Distribution of
heat-shock protein 60 immunoreactivity in testes of infertile
men. Cell Tissue Res 1997; 288: 539_44.
19 Feng HL, Sandlow JI, Sparks AE. Decreased expression of the
heat shock protein hsp70-2 is associated with the
pathogenesis of male infertility. Fertil Steril 2001; 76: 1136_9.
20 Zhang XS, Lue YH, Guo SH, Yuan JX, Hu ZY, Han CS,
et al. Expression of HSP105 and HSP60 during germ cell apoptosis
in the heat-treated testes of adult cynomolgus monkeys
(Macaca fascicularis). Front Biosci 2005; 10: 3110_21.
21 Zhou XC, Han XB, Hu ZY, Zhou RJ, Liu YX. Expression of
Hsp70-2 in unilateral cryptorchid testis of rhesus monkey
during germ cell apoptosis. Endocrine 2001; 16: 89_95.
22 Guo CX, Ma J, Zhou XC, Liu YX. Expression of
HSP70-2 gene during germ cell apoptosis in rat unilateral cryptorchid
testes. Arch Androl 2001; 46: 109_15.
23 Widlak W. [The heat shock response and
HSP70 gene expression in male germ cells.] Postepy Biochem 2006; 52: 289_95.
(In Polish.)
24 Widlak W, Winiarski B, Krawczyk A, Vydra N, Malusecka E,
Krawczyk Z. Inducible 70 kDa heat shock protein does not
protect spermatogenic cells from damage induced by
cryptorchidism. Int J Androl 2007; 30: 80_7.
25 Vydra N, Malusecka E, Jarzab M, Lisowska K,
Glowala-Kosinska M, Benedyk K, et al. Spermatocyte-specific
expression of constitutively active heat shock factor 1 induces
HSP70i-resistant apoptosis in male germ cells. Cell Death
Differ 2006; 13: 212_22.
26 Zakeri ZF, Welch WJ, Wolgemuth DJ. Characterization and
inducibility of hsp 70 proteins in the male mouse germ line. J
Cell Biol 1990; 111: 1785_92.
27 Hayashida N, Inouye S, Fujimoto M, Tanaka Y, Izu H, Takaki
E, et al. A novel HSF1-mediated death pathway that is
suppressed by heat shock proteins. EMBO J 2006; 25: 4773_83.
28 Kaneko Y, Kimara T, Kishishita M, Noda Y, Fujita J. Cloning
of apg-2 encoding a novel member of heat shock protein 110
family. Gene 1997; 189: 19_24.
29 Kaneko Y, Nishiyama H, Nonoguchi K, Higashitsuji H,
Kishishita M, Fujita J. A novel hsp110-related gene,
apg-1, that is abundantly expressed in the testis responds to a low
temperature heat shock rather than the traditional elevated
temperatures. J Biol Chem 1997; 272: 2640_5.
30 Majumdar SS, Winters SJ, Plant TM. Procedures for the
isolation and culture of Sertoli cells from the testes of infant,
juvenile, and adult rhesus monkeys (Macaca
mulatta). Biol Reprod 1998; 58: 633_40.
31 Yu FQ, Han CS, Yang W, Jin X, Hu ZY, Liu YX. Activation of
the p38 MAPK pathway by follicle-stimulating hormone
regulates steroidogenesis in granulosa cells differentially. J
Endocrinol 2005; 186: 85_96.
32 Jin X, Han CS, Zhang XS, Yuan JX, Hu ZY, Liu YX. Signal
transduction of stem cell factor in promoting early follicle
development. Mol Cell Endocrinol 2005; 229: 3_10.
33 Zhang XS, Zhang ZH, Guo SH, Yang W, Zhang ZQ, Yuan JX,
et al. Activation of extracellular signal-related kinases 1 and 2
in Sertoli cells in experimentally cryptorchid rhesus monkeys.
Asian J Androl 2006; 8: 265_72.
34 Zhang XS, Zhang ZH, Jin X, Wei P, Hu XQ, Chen M,
et al. Dedifferentiation of adult monkey Sertoli cells through
activation of extracellularly regulated kinase 1/2 induced by heat
treatment. Endocrinology 2006; 147: 1237_45.
35 Sharpe RM, McKinnell C, Kivlin C, Fisher JS. Proliferation
and functional maturation of Sertoli cells, and their relevance
to disorders of testis function in adulthood. Reproduction
2003; 125: 769_84.
36 Gething MJ, Sambrook JF. Protein folding in the cell. Nature
1992; 355: 33_45.
37 Parsell DA, Lindquist S. The function of heat-shock proteins
in stress tolerance: degradation and reactivation of damaged
proteins. Annu Rev Genet 1993; 27: 437_96.
38 Zhao ZG, Ma QZ, Xu CX. Abrogation of heat-shock protein
(HSP)70 expression induced cell growth inhibition and
apoptosis in human androgen-independent prostate cancer cell
line PC-3m. Asian J Androl 2004; 6: 319_24.
39 Nonoguchi K, Tokuchi H, Okuno H, Watanabe H, Egawa H,
Saito K, et al. Expression of Apg-1, a member of the Hsp110
family, in the human testis and sperm. Int J Urol 2001; 8:
308_14.
40 Tavaria M, Gabriele T, Kola I, Anderson RL. A hitchhiker's
guide to the human Hsp70 family. Cell Stress Chaperones
1996; 1: 23_8.
41 Widlak W, Vydra N, Malusecka E, Dudaladava V, Winiarski
B, Sciegliñska D, et al. Heat shock transcription factor 1
down-regulates spermatocyte-specific 70 kDa heat shock
protein expression prior to the induction of apoptosis in mouse
testes. Genes Cells 2007; 12: 487_99.
42 Eddy EM. Role of heat shock protein HSP70-2 in
spermatogenesis. Rev Reprod 1999; 4: 23_30.
43 Meinhardt A, Wilhelm B, Seitz J. Expression of
mitochondrial marker proteins during spermatogenesis. Hum Reprod
Update 1999; 5: 108_19.
44 Rohde M, Daugaard M, Jensen MH, Helin K, Nylandsted J,
Jaattela M. Members of the heat-shock protein 70 family
promote cancer cell growth by distinct mechanisms. Genes
Dev 2005; 19: 570_82.
45 Mosser DD, Caron AW, Bourget L, Denis-Larose C, Massie B.
Role of the human heat shock protein hsp70 in protection against
stress-induced apoptosis. Mol Cell Biol 1997; 17: 5317_27.
46 Buzzard KA, Giaccia AJ, Killender M, Anderson RL. Heat
shock protein 72 modulates pathways of stress-induced
apoptosis. J Biol Chem 1998; 273: 17147_53.
47 Wei YQ, Zhao X, Kariya Y, Teshigawara K, Uchida A.
Inhibition of proliferation and induction of apoptosis by abrogation
of heat-shock protein (HSP) 70 expression in tumor cells.
Cancer Immunol Immunother 1995; 40: 73_8.
48 Nylandsted J, Brand K, Jaattela M. Heat shock protein 70 is
required for the survival of cancer cells. Ann NY Acad Sci
2000; 926: 122_5.
49 Allen RL, O'Brien DA, Eddy EM. A novel hsp70-like protein
(P70) is present in mouse spermatogenic cells. Mol Cell Biol
1988; 8: 828_32.
50 Allen RL, O'Brien DA, Jones CC, Rockett DL, Eddy EM.
Expression of heat shock proteins by isolated mouse
spermatogenic cells. Mol Cell Biol 1988; 8: 3260_6.
51 Cheng MY, Hartl FU, Martin J, Pollock RA, Kalousek F,
Neupert W, et al. Mitochondrial heat shock protein hsp60 is
essential for assembly of proteins imported into yeast
mitochondria. Nature 1989; 337: 620_5.
52 Kyriakis JM, Avruch J. Mammalian mitogen-activated
protein kinase signal transduction pathways activated by stress
and inflammation. Physiol Rev 2001; 81: 807_69.
53 Matsuzawa A, Ichijo H. Molecular mechanisms of the decision
between life and death: regulation of apoptosis by apoptosis
signal-regulating kinase 1. J Biochem 2001; 130: 1_8.
54 Guo J, Tao SX, Chen M, Shi YQ, Zhang ZQ, Li YC,
et al. Heat treatment induces liver receptor homolog-1 expression in
monkey and rat Sertoli cells. Endocrinology 2007; 148: 1255_65.
|